Protocol 34825: End Point Analysis Assay - Plcg2<em3Adiuj>

B6(SJL)-Apoe^{tm1.1(APOE*4)Adiuj} Plcg2^em3Adiuj App^em1Adiuj Trem2^em1Adiuj/J

Stock No: 034454

Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = T, T

Wild type = A, C

Sequence

 

ACAATGACCACCATGGTCAACGTGGACACCCTTCCAGAATATGAGAAGAGTCAGATCAAGAGAGCGCTGGAGTTAGGGACGGTG(a/t)TGAC(c/t)GTGTTCAACGCCCGCAAATCCACCCCAGAGCGGAGGACAGTACAGATGATCATGGAGACTCGGCAGGT

JAX Protocol

Protocol Primers

Primer	5' Label	Sequence 5' → 3'	3' Label	Primer Type	Reaction	Note
44584		GAT CAA GAG AGC GCT GGA GT		Forward	A
44586		TGT ACT GTC CTC CGC TCT GG		Reverse	A
44588	Fluorophore-1	ACG GTG ATG ACC GTG TTC A	Quencher-1	WT Probe
44589	Fluorophore-2	ACG GTG TTG ACT GTG TTC AAC G	Quencher-2	MUT Probe

Reaction A

Component	Final Concentration
Kapa Probe Fast QPCR	1.00 X
ddH2O
44584	0.40 uM
44586	0.40 uM
Wt Probe	0.15 uM
Mutant Probe	0.15 uM
DNA

Cycling

Step	Temp °C	Time	Note
1	95.0	--
2	95.0	--
3	60.0	--
4		--	repeat steps 2-3 for 40 cycles
5	40.0	--	Forever

JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number	Strain Name
034454	B6(SJL)-Apoe^tm1.1(APOE*4)Adiuj Plcg2^em3Adiuj App^em1Adiuj Trem2^em1Adiuj/J
030674	B6.Cg-Apoe^tm1.1(APOE*4)Adiuj Plcg2^em3Adiuj Trem2^em1Adiuj/J
2 strains use this protocol