For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 034418
Protocol 36976: Probe Assay - Psip1<em1(IMPC)J>
Version 1.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr4:83482138-83482264 127bp TCATAGAGATGAGCTAGCCTGAG TAAGGAAGCTTAAAGGGCTTGAC
Mut = 139 bp
Wt = 127 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
TGGAGCTGATCTGGGGGCCGGGAGGGAAACGGGCTCTATTACAATAAACTGTAAAATGGGTTGATCCTGTGTTAGACATATTTGGGGCTCTTTACTCTGAGTTCACTCAGGTGTActaaggtttgtaagatctgactttcctttcttacaggtagatgaagttcctgatggagctgtaaaaccacccacaaacaaactacccattttcttttttggaacccatgagacgtaagtcctgctagctttaagctgaaatgacagttaacttgcagaagttaggtataaaacaaaaagcaagtagaaatttcaaaatttaagtgggatgtgacaatgaaattaaaaacttatatttttaaagacatagtctcttgtagccctggttgccctaggatgttccaatgagacccggctagcctgagctcatagagatgagctagcctgagctcatggagatcaacttgttgtttgcctcctATGTTTGGAGATAAAATGCCATACCTGGACTGGAATAGAAAACTTAAAAAGTCAAGCCCTTTAAGCTTCCTTAAAAATTGTAAAATGTACTTTCCCGTTTAATGCCA
This mutation is a 359 bp deletion beginning at Chromosome 4 position 83,482,211 bp and ending after 83,482,569 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 50164 | TAA GGA AGC TTA AAG GGC TTG AC | Common | A | |||
| 50165 | TCA TAG AGA TGA GCT AGC CTG AG | Wild type Forward | A | |||
| 50166 | TGT AAA ATG GGT TGA TCC TGT G | Mutant Forward | A | |||
| 50167 | Fluorophore-1 | ATG GAG ATC AAC TTG TTG TTT GCC | Quencher-1 | WT Probe | ||
| 50168 | Fluorophore-2 | CTG AGT TCA CTC AGG TGT AAT GTT TGG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 50164 | 0.40 uM |
| 50165 | 0.40 uM |
| 50166 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.