For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 034395
Protocol 36931: Probe Assay - Ss18<em1(IMPC)J>
Version 1.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr18:14679365-14679469 105bp TTTCAGATGCTGGATGAAAAC ACCAAGAGCTTGTCTGTCTTACTGC
Mut = 139 bp
Wt = 105 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
AACTAGATGGTTTTATAATCTGAAGTGGCTTTGAGGAAACAATGTTTCGCTTCTTTGCAGTGTCGTGttcatggataccttctcttggcttcttggttttgaattttactggatatacaggtttataatgaactctctggcttagttttgagttttactcgatgtacaggtttataatgaactctctggttttaatttcagatgctggatgaaaacaaccatcttattcagtgtataatggactatcagaacaaagggaaggcctcggagtgctcgcagtaagacagacaagctcttggtcttgggtcttgTGGTTGTTACTTGTTACTTTGTCTTTGAGTTATTTAT
This mutation is a 244 bp deletion beginning at Chromosome 18 position 14,679,354 bp and ending after 14,679,597 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 50065 | TTT CAG ATG CTG GAT GAA AAC | Wild type Forward | A | |||
| 50066 | ACC AAG AGC TTG TCT GTC TTA CTG C | Wild type Reverse | A | |||
| 50067 | AGT GGC TTT GAG GAA ACA ATG | Mutant Forward | A | |||
| 50068 | GGT GAC AGT ACC ATG ACT CTA CAA G | Mutant Reverse | A | |||
| 50069 | Fluorophore-1 | AAA GGG AAG GCC TCG GAG T | Quencher-1 | WT Probe | ||
| 50070 | Fluorophore-2 | TGC AGT GTC GTG TGG TTG TTA CTT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 50065 | 0.40 uM |
| 50066 | 0.40 uM |
| 50067 | 0.40 uM |
| 50068 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.