Protocol 37472: Probe Assay - Mecom<em1(IMPC)J> Alternate 2
Version 3.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr3:29993423-29993532 110bp AACCAGGACTGTAAGGAATGTGA TCAAACTCCAGCATAACACTTTGC

Mut = 102 bp

Wt = 110 bp

Fam = Mut

Hex = Wt

 

Sequence

Wt Sequence (deletions in lower case):

 CTCCCCCTTCCCCTCCCCTTCCCCTCCCCCTCCCCTTCCCCCTCCCCCCCCTCTCTCTTTCTAAGCAAACTATGGGCTGTGTTTTGTGTAACTCCATAAGAcggctggttatggtgatgaggacttttggatcccaccttgctagctaaagatccttgcactgtttctacagaagaacggcagcaccgctgtgaggactgtgaccagctctttgaatccaaggcagagctagccgatcaccagaagttcccatgcagcacacctcactcggccttctccatggtggaggaggacttgcaacaaaacctggagagtgagagcgatctccgagagatccatggcaaccaggactgtaaggaatgtgaccgagttttccccgatctgcaaaggttagagaagacatggtgaacgtgggtgtgtgctctgcagcaaagtgttatgctggagtttgacaagtttgctcgggGGAAGACTAGAGCTTCAAAACAACTGGCCAGATGTGCTGGTGGCATGCTTGGGAATCATTGCTTCCTTAAAAAGCCTTGTCCTTAAGATACTTACAGTGGACCTGGATCATTTTTGTCAATCAGAAAATATTCCATCCCTTCC

This mutation is a 365 bp deletion beginning at Chromosome 3 position 29,993,409 bp and ending after 29,993,773 bp (GRCm38/mm10).

 

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
49716 AAC CAG GAC TGT AAG GAA TGT GA Wild type Forward A
49717 Fluorophore-1 ACA TGG TGA ACG TGG GTG TG Quencher-1 WT Probe
51387 TCA AAC TCC AGC ATA ACA CTT TGC Wild type Reverse A
51388 AAG CAA ACT ATG GGC TGT GT Mutant Forward A
51389 AGC AAT GAT TCC CAA GCA Mutant Reverse A
51390 Fluorophore-2 AAC AAC TGG CCA GAT GTG CTG Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
49716 0.40 uM
51387 0.40 uM
51388 0.40 uM
51389 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.