For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
Mutant= 97 bp
Wild Type = 97 bp
GGCTtcttgGGGCA(G/A)CACTGGTGGGA
Mut =A
WT= G
>chr7:87429155-87429251 97bp ACTTGGAACAAGCCAGTCGT AGCCTACTGCTAAGCCCAGA
Wt Sequence:
Mutant Sequence:
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
36462 | ACT TGG AAC AAG CCA GTC GT | Forward | A | |||
36463 | AGC CTA CTG CTA AGC CCA GA | Reverse | A | |||
36464 | Fluorophore-1 | CTT GGG GCA GCA CTG GT | Quencher-1 | WT Probe | ||
36465 | Fluorophore-2 | TTC TTG GGG CAA CAC TGG T | Quencher-2 | MUT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
36462 | 0.40 uM |
36463 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |
Stock Number | Strain Name |
---|---|
034245 | FVB(129P2)-Pde6b+ Gtf2iem2Jdd Gtf2ird1em2Jdd Tyrc-ch/Mmjax |
034672 | FVB(129P2)-Pde6b+ Gtf2ird1em3Jdd Tyrc-ch/Mmjax |
004624 | FVB.129P2-Pde6b+ Tyrc-ch Fmr1tm1Cgr/J |
004828 | FVB.129P2-Pde6b+ Tyrc-ch/AntJ |
038293 | FVB.Cg-Pde6b+ Tyrc-ch Ccdc198em1Iad/J |
000271 | SH1/LeJ |
6 strains use this protocol |