For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr9:27037322+27037410 89bp TAGCAGTTCAAAGGGTGAAGCA GCATGCCTGAATTGTTATTTC
Mut = 90 bp
Wt = 89bp
Fam = Mut
Hex = Wt
Wt Sequence (deletions in lower case; bp changes in brackets with wt first and insertions with carrots ^g^ (g insertion):
This mutation is a 494 bp deletion beginning at Chromosome 9 position 27,036,876 bp and ending after 27,037,369 bp (GRCm38/mm10).
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
49346 | GCA TGC CTG AAT TGT TAT TTC | Common | A | |||
49347 | TAG CAG TTC AAA GGG TGA AGC A | Wild type Forward | A | |||
49348 | TGG AGC CCT TGA GAC TAC AG | Mutant Forward | A | |||
49349 | Fluorophore-1 | AAG GAA GAG CGT CAG ACA AAC CA | Quencher-1 | WT Probe | ||
49350 | Fluorophore-2 | ACA GGT GTT TCC TTA ATC TTT ATG ACA GCT | Quencher-2 | MUT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
49346 | 0.40 uM |
49347 | 0.40 uM |
49348 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |