Protocol 36946: Probe Assay - Ist1<em1(IMPC)J> Alternate2
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  110 bp

Wild Type = 108 bp

>chr8:109682459-109682566 108bp TCTGGAATTTGAGGATGGAGT TTCACTAACAGGCAAAAGATCC

 

Sequence

AGGAAGAGCAGTTGGTGCTCTTAACCACTGAGCCATCTCTCCAGCCCCAGTGTACAATCTTCTCTGTACAAGATGGCAAATTCTAGAACAGTAATGAGGGGAGTAGATGTGctaaggggctgtgaggtaggctgctgtagattacagcagccgtcttctctggtgggtgaaggtcgtcttctctggtgggtgaaggtcgtgttctctggtgggtggaggtctgccagggcccagtgcactactgctgtgtgactggagtgggatttgtgtcccagcggaactggctcagaaggcaaggaaggagattgctgactacctggccgccggaaaggatgagcgagcacgcatccgtgtggagcacataatccgggaggactacctcgtggaggccatggagatcctggagctgtattgtgacctgctgctggcgcgctttggccttatccagtctatgaagtaagatatctcacctcagaggctaaacatatctggaatttgaggatggagtaatagtttctcagcctgtgtggatctgcagcaggctaacactgagaggttctttcacattcccaaggatcttttgcctgttagtgaaaagaaagcagaccctgaagtccagtgtctcaggtttgagtctcgcttgggtcagcttgtctgagatttgtgcacttgggcatgtcacttagttttagtttctccacaagcaaaatagggaaatgaaattgctagaatgccagttaccagaagccagtgtaattgtgaaataactgtggatgtcatctggtatgtgacgtgacaactatggcttttgttggtttgttttaaaggatgttaaatgacatatttttttcttcactagggagctagattctggtctagctgaatccgtgtctacactgatctgggctgcgcctcggcttcagtcagaagtggctgagttgaaaatagtgagtataagcaatttctataatgtcggtaggttttgttatagacaaagtctcactgtgtcactggccagtctctctggcctggaacttatatccaaacctagaactcccagaattctcctcttctctgcctctgagagtgCTGGAATGAAAGGAAATGCCATCATGCCTAGCCTGGGGAGGTTTTTGGTATCTTAATTAAAGTCTGTTTATTGAGC

AGGAAGAGCAGTTGGTGCTCTTAACCACTGAGCCATCTCTCCAGCCCCAGTGTACAATCTTCTCTGTACAAGATGGCAAATTCTAGAACAGTAATGAGGGGAGTAGATGTGctaaggggctgtgaggtaggctgctgtagattacagcagccgtcttctctggtgggtgaaggtcgtcttctctggtgggtgaaggtcgtgttctctggtgggtggaggtctgccagggcccagtgcactactgctgtgtgactggagtgggatttgtgtcccagcggaactggctcagaaggcaaggaaggagattgctgactacctggccgccggaaaggatgagcgagcacgcatccgtgtggagcacataatccgggaggactacctcgtggaggccatggagatcctggagctgtattgtgacctgctgctggcgcgctttggccttatccagtctatgaagtaagatatctcacctcagaggctaaacatatctggaatttgaggatggagtaatagtttctcagcctgtgtggatctgcagcaggctaacactgagaggttctttcacattcccaaggatcttttgcctgttagtgaaaagaaagcagaccctgaagtccagtgtctcaggtttgagtctcgcttgggtcagcttgtctgagatttgtgcacttgggcatgtcacttagttttagtttctccacaagcaaaatagggaaatgaaattgctagaatgccagttaccagaagccagtgtaattgtgaaataactgtggatgtcatctggtatgtgacgtgacaactatggcttttgttggtttgttttaaaggatgttaaatgacatatttttttcttcactagggagctagattctggtctagctgaatccgtgtctacactgatctgggctgcgcctcggcttcagtcagaagtggctgagttgaaaatagtgagtataagcaatttctataatgtcggtaggttttgttatagacaaagtctcactgtgtcactggccagtctctctggcctggaacttatatccaaacctagaactcccagaattctcctcttctctgcctctgagagtgCTGGAATGAAAGGAAATGCCATCATGCCTAGCCTGGGGAGGTTTTTGGTATCTTAATTAAAGTCTGTTTATTGAGC

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
48707 GAT ACC CAG CTC AAT AAA CAG ACT Mutant Reverse A
50118 TCT GGA ATT TGA GGA TGG AGT Wild type Forward A
50122 TTC ACT AAC AGG CAA AAG ATC C Wild type Reverse A
50123 Fluorophore-1 CCT GTG TGG ATC TGC AGC AGG Quencher-1 WT Probe
50125 GAA CAG TAA TGA GGG GAG TAG ATG T Mutant Forward A
50126 Fluorophore-2 AGG AAA TGC CAT CAT GCC TAG CC Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
48707 0.40 uM
50118 0.40 uM
50122 0.40 uM
50125 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.