Protocol 36411: Probe Assay - Zmym2<em1(IMPC)J>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr14:56912825+56912982 158bp GTGATTTCCTGGATCTAAAAATGG AACAATGGTTCCCTTCATTG

Mut= 168 bp

Wt= 158 bp

Fam=Mut

Hex=Wt

Sequence

Wt Sequence (deletion in lower case; and insertion with carrots ^g^ (GCATGATT insertion):

 TTATAGATATGAGCCACCATGCTTGGCAAGTGGTGCATTTAAGTAGACTATTTTGTGTAGTAATCTCGTTTACCTATTAATCAGTTGGGAAGGGGAATTGAACAGGCAGTGTCAGTTTAAATAAATAATTATTCTTTTATTCCATGTTGTTATAGAAATTTTATTTTAATGTTTCCAATATCTGAAAGCCATGTTAATGTATTTGAAGATAAATTAATTTTGACTTTTAATCTTTTCTGAGAGTTCATATTTTATACTAAAAGTGATTTCCTGGATCTAAAAATGGTGTTTGATTTCCATGAT^ctaatctgtggttaaaatatcagttataacctttatttttggtttcttatgaaatggagctttaagttgtacctcttgtttttcagagatataactacaatgaagggaaccattgttgctcaagtggactcaagtgagtccttccaagaattttgtagtacatcttgtttgtctctctatgaggacaaacagagtcctgctaaaggagctctaaataaatcaagatgcacaatctgtggcaaattaactgaggtttgtacttctgtacttttcatttacttgtatgagaaaagagttcagattttaacagttttcctgtac^TCTATATTGATGCATGTATTCTCAGAATGATGATATGCAAGACTAGGATTCATAAGACTAGAATTGTATAATTCACCCAAAAGAGTAAGTAGTATTATGATTGCTCTTTTTGGTTGTTGTTTTTTGTTTTTTGTTTTTCGAGACAGGGTTTCTCTGTATAGCCCTGGCTGTTCTGGAACTCACTTTGTAGACCAGGCTGGCCTCAAACTCAGAAATCTGCCTGCCTCTGCCTAGGATCAAAGGCGTGCGCCACCACACCCGGCTTGCTTTTTCTTTTTTATTGGTCTAATAATATGTTTATTTATACAAATAGACTGACTATACAAGAAA

This mutation is a 321 bp deletion beginning at Chromosome 14 position 56,912,866 bp and ending after 56,913,186 bp (GRCm38/mm10). In addition, there is an 8 bp insertion (GCATGATT) at the deletion site.  

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
48699 GTG ATT TCC TGG ATC TAA AAA TGG Common A
48700 AAC AAT GGT TCC CTT CAT TG Wild type Reverse A
48701 CAA CAA CCA AAA AGA GCA ATC Mutant Reverse A
48702 Fluorophore-1 ATG AAA TGG AGC TTT AAG TTG TAC CTC Quencher-1 WT Probe
48703 Fluorophore-2 ATG CAT GAT TTC TAT ATT GAT GCA TGT Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
48699 0.40 uM
48700 0.40 uM
48701 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.