Protocol 36409: Probe Assay - Taf5<em1(IMPC)J>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr19:47075162+47075306 145bp AGGAGCAAACTGACAACAATG CCCAAATCCTCACATATACCA

Mut= 125 bp

Wt= 145 bp

Fam=Mut

Hex=Wt

Sequence

Wt Sequence (deletion in lower case):

 AGTGTTGGGATTAAAGAAAGACGTGCACCACCATGGGTCAAAGATGGTTTTCAAAAGAAATACATACTGGTAGTGAGTCTTAGGTCTGCTCAGAAGCCCCATTCACTGCATAATTCCAGAAGGTTCTCCTGAAGTGCTTATCATACGTTTCAGTAGAGAAATGGGTGGCTTTAGAAACTGAGTTATAATCATTTTGAAATATATTACTATTGATCCTACAgcctagtcagggttatttatatagttccattattacaaatatataattatatgctagctaccgatgattctgggatggtttataaatgtatgagggagaagctgattaccttaatgacacattgaaaaatgactctttaaaaatcactaaaacaggttccatggagatcaggaatgttactaccaggatgacctacgagtgttatctagtcttaccaaaaaggagcacatgaaagggaacgagaccatgctggactttcggacgagtaaattcgttctccgcatttcccgggactcgtaccagctcttgaagcggcatctccaggagaagcagaacaatcagatctggaacatcgtgcaggagcacctctacatcgacatcttcgacgggatgcctcgcagtaagcaacagatcgacgccatggtgggcagcctggcaggagaggcgaaacgagaggcgaacaaatcgaaggtacgggagctaacctagaatgatgtaatgtgcaggagcaaactgacaacaatgtcatgtgagtttccattatataatggaaattatgtatacattcttataactaccttggGAGGAATCCAGTACTGCATTTAAAATGTGTTGTTCTGAAGATTTGTGGTATATGTGAGGATTTGGGAATGGTTTCGAGTAACAGAGCCTTAACTGCAGAGGCTAAGACGAGCAAGGTTTGTTTGTTTTTTTTTTTTTTTTTTTTGCTTTTGCTTTTGCTTCTGAGACCCGCATAATAATTCCAAAGTGCAGTCTATACCTCTTGGCTTGTGGCTCCT

This mutation is a 583 bp deletion beginning at Chromosome 19 position 47,074,658 bp and ending after 47,075,240 bp (GRCm38/mm10).

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
48689 AGG AGC AAA CTG ACA ACA ATG Wild type Forward A
48690 CCC AAA TCC TCA CAT ATA CCA Common A
48691 TGG GTG GCT TTA GAA ACT GA Mutant Forward A
48692 Fluorophore-1 CAT GTG AGT TTC CAT TAT ATA ATG GAA A Quencher-1 WT Probe
48693 Fluorophore-2 CTA TTG ATC CTA CAG AGG AAT CCA GT Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
48689 0.40 uM
48690 0.40 uM
48691 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.