Protocol 36396: Probe Assay - Exosc2<em1(IMPC)J>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr2:31674438+31674540 103bp TCCCTTCTGTTTGTTCAGCC CAATGTCTCCGACCTCTCCA

Mut= 103 bp

Wt= 104 bp

Fam=Mut

Hex=Wt

Sequence

Wt Sequence (deletion in lower case):

 CACCATTAGAACTCAGTGAGCTCACTGTAATTGAGGGAGCTCTGACCAGAAAAGAGACACAGTCCAATGCCTGGGCCTTAACAAAGGGCATTTCACCCTTGGAATCAGGGTGAGGGACCAGCAAAGTGTCTGAGCCAGGCAGGCAGTGTGGACATGTAACAGCTTGCAGTGAGCAGATGCTTTAAGGATAGCTAATGAGAGTCTGAAGTTCCCAGGTCTAAACAGTAATTATACCCATGTGCTAAAAAAGATGGTTATTGCCTCCCTTCTGTTTGTTCAGCCTCAGACACTGTGTGGCCAGCCCGCTggctattggtaagcttctgttttctcttgcagatacaatggagaggtcggagacattgtagtggggagaatcacagaggtaaagtcagtgttcataaagagaaggaggctggcggctcagggattggggccttcatctgtgaaagtatgaagaaggggccctttgtttctggggtggtgtgaaatgctatcccacatttatttctctcacaggttcaacagaagaggtggaaggtagagaccaattccaggctggactccgtcttgctcctctcatccatgaacctacctgggggagagctggtgagtgctcgcctgctctggaactgtccggtcggtcgggctgtggggctttgctccacctgagaagtctgcttcaCATGAGGTTGCTGTGGTTTTGTCACCAGATCTGCTACTTTGGTGAACACAGAGGCTTTTCTTCTAGCCCTGTGCTCTCAACATGGGCAGCAGCTTGTGTGTGGTAAGACCAGAAACACCCATGGCGTGGGCTCCCAGGAGGGAGCTGAGAGGAGGCTCTTGGGTCTTAGGATCTTAGTGCTGATTTCCTTTCTTGATGCCCAGCCTTGCACAGGGAAGGTGTCTCTTGAGGGGTTTGCCTTAGCTTGCTTGCTTTTTGGAGTGTGGGGTGGGTGGGGTTGAGACAAGGTTTCTCAGTGTAGCCCTGACCTGGAACT

This mutation is a 378 bp deletion beginning at Chromosome 2 position 31,674,483 bp and ending after 31,674,860 bp (GRCm38/mm10).

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
48640 TCC CTT CTG TTT GTT CAG CC Common A
48641 CAA TGT CTC CGA CCT CTC CA Wild type Reverse A
48642 AAA AGC CTC TGT GTT CAC CA Mutant Reverse A
48643 Fluorophore-1 AAG CTT CTG TTT TCT CTT GCA GAT AC Quencher-1 WT Probe
48644 Fluorophore-2 CTC ATG AGG TTG CTG TGG TTT Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
48640 0.40 uM
48641 0.40 uM
48642 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.