For in-depth product & services help, ask our
Technical Information Scientists
Protocol 39938: End Point Analysis Assay - Ptk2b_rs73223431-alt1
Version 1.0
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant = T/T
Heterozygote = C/T
Wild type = C/C
The WT and Mut probes (primers 54464 and 54465) anneal over the nucleotide sequence containing mouse genomic variation rs234452903.
>chr14:66244402-66244466 65bp GCTTGCTACAGACATCCTTCC CCAGTGAGGGCACAGAAGTT
Sequence
SEQ
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 54462 | GCT TGC TAC AGA CAT CCT TCC | Forward | A | |||
| 54463 | CCA GTG AGG GCA CAG AAG TT | Reverse | A | |||
| 54464 | Fluorophore-1 | AGA GGT CCT TCA GCT GTT GG | Quencher-1 | WT Probe | ||
| 54902 | Fluorophore-2 | CAG AGG TCC TTT AGC TGT TG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 54462 | 0.40 uM |
| 54463 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.