Protocol 35381: End Point Analysis Assay - App<em5Adiuj>

B6.Cg-Epha1^em1Adiuj Apoe^{tm1.1(APOE*4)Adiuj} App^em1Adiuj Trem2^em1Adiuj/J

Stock No: 033875

Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = TC
Heterozygote = GA/TC
Wild type = GA

>chr16:84965882-84966009 128bp GGCTGACAAACATCAAGACG AATCTCGGGGAGAGGCAGT

Sequence

GTTCTGGGCTGACAAACATCAAGACGGAAGAGATCTCGGAAGTGAA(ga/tc)TGGATGCAGAATTCGGACATGATTCAGGATTTGAAGTCCGCCATCAAAAACTG

JAX Protocol

Protocol Primers

Primer	5' Label	Sequence 5' → 3'	3' Label	Primer Type	Reaction	Note
45910		GGC TGA CAA ACA TCA AGA CG		Forward	A
45912	Fluorophore-1	CGG AAG TGA AGA TGG ATG CA	Quencher-1	WT Probe
45913	Fluorophore-2	CGG AAG TGA ATC TGG ATG CA	Quencher-2	MUT Probe
46180		AAT CTC GGG GAG AGG CAG T		Reverse	A

Reaction A

Component	Final Concentration
Kapa Probe Fast QPCR	1.00 X
ddH2O
45910	0.40 uM
46180	0.40 uM
Wt Probe	0.15 uM
Mutant Probe	0.15 uM
DNA

Cycling

Step	Temp °C	Time	Note
1	95.0	--
2	95.0	--
3	60.0	--
4		--	repeat steps 2-3 for 40 cycles
5	40.0	--	Forever

JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number	Strain Name
033875	B6.Cg-Epha1^em1Adiuj Apoe^tm1.1(APOE*4)Adiuj App^em1Adiuj Trem2^em1Adiuj/J
038908	B6.Cg-Tc(HSA17)2Mdk App^em1Adiuj/J
2 strains use this protocol