Protocol 35381: End Point Analysis Assay - App<em5Adiuj>
Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = TC
Heterozygote = GA/TC
Wild type = GA

>chr16:84965882-84966009 128bp GGCTGACAAACATCAAGACG AATCTCGGGGAGAGGCAGT

Sequence

GTTCTGGGCTGACAAACATCAAGACGGAAGAGATCTCGGAAGTGAA(ga/tc)TGGATGCAGAATTCGGACATGATTCAGGATTTGAAGTCCGCCATCAAAAACTG

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
45910 GGC TGA CAA ACA TCA AGA CG Forward A
45912 Fluorophore-1 CGG AAG TGA AGA TGG ATG CA Quencher-1 WT Probe
45913 Fluorophore-2 CGG AAG TGA ATC TGG ATG CA Quencher-2 MUT Probe
46180 AAT CTC GGG GAG AGG CAG T Reverse A

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
45910 0.40 uM
46180 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.