For in-depth product & services help, ask our
Technical Information Scientists
Protocol 39939: End Point Analysis Assay - Cd2ap_rs4715019-alt1
Version 1.0
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant = T, A
Wild type = G, T
>chr17:42875298-42875376 79bp TCGATGCTGCTTAAAACCATT TCCTGTTTTTGTTGGGCTTC
Sequence
TCAGAAAGACATTATCACGTTCTCACTCCAGAGTCGATGCTGCTTAAAACCATTACTGAAATTAATAATTCA(g/t)GAAAC(t/a)AGCGGATGATTTAGAAGCCCAACAAAAACAGGAGCTCTGCTGATGTGGCACCCCGTGCCCACACTT
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 54477 | TCG ATG CTG CTT AAA ACC ATT | Forward | A | |||
| 54478 | TCC TGT TTT TGT TGG GCT TC | Reverse | A | |||
| 54480 | Fluorophore-1 | ATT CAT GAA ACA AGC GGA TGA TT | Quencher-1 | MUT Probe | ||
| 54903 | Fluorophore-2 | ATA ATT CAG GAA ACT AGC GGA TGA | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 54477 | 0.40 uM |
| 54478 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.