Protocol 37655: End Point Analysis Assay - Bin1 JR30670 (rs10194375)
Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = T/T
Heterozygote = G/T
Wild type = G/G

>chr18:32397306+32397435 130bp TTGGCTGATCCTAGCTCTGT AGGCCAAAGGTCTGTCCATC

Sequence

AGCTTGGCTGATCCTAGCTCTGTATGAGCGGGGTGTAGGGGTGAGGAGGGACCCATTA(g/t)AGGAATACCCTAGAGAATCAGAGAATCAGTGTAAAACTCAGGGGTACCTGGGCGGATGGACAGACCTTTGGCCTG

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
51892 TTG GCT GAT CCT AGC TCT GT Forward A
51893 AGG CCA AAG GTC TGT CCA TC Reverse A
51894 Fluorophore-1 AGG GAC CCA TTA GAG GAA TAC C Quencher-1 WT Probe
51895 Fluorophore-2 AGG GAC CCA TTA TAG GAA TAC CC Quencher-2 MUT Probe

Reaction A

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTPS-kapa 0.26 mM
51892 0.50 uM
51893 0.50 uM
Glycerol 6.50 %
Dye 1.00 X
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
1 95.0 --
2 95.0 --
2 95.0 --
3 60.0 -- repeat steps 2-3 for 40 cycles
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.