For in-depth product & services help, ask our
Technical Information Scientists
Protocol 37655: End Point Analysis Assay - Bin1 JR30670 (rs10194375)
Version 1.0
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant = T/T
Heterozygote = G/T
Wild type = G/G
>chr18:32397306+32397435 130bp TTGGCTGATCCTAGCTCTGT AGGCCAAAGGTCTGTCCATC
Sequence
AGCTTGGCTGATCCTAGCTCTGTATGAGCGGGGTGTAGGGGTGAGGAGGGACCCATTA(g/t)AGGAATACCCTAGAGAATCAGAGAATCAGTGTAAAACTCAGGGGTACCTGGGCGGATGGACAGACCTTTGGCCTG
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 51892 | TTG GCT GAT CCT AGC TCT GT | Forward | A | |||
| 51893 | AGG CCA AAG GTC TGT CCA TC | Reverse | A | |||
| 51894 | Fluorophore-1 | AGG GAC CCA TTA GAG GAA TAC C | Quencher-1 | WT Probe | ||
| 51895 | Fluorophore-2 | AGG GAC CCA TTA TAG GAA TAC CC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTPS-kapa | 0.26 mM |
| 51892 | 0.50 uM |
| 51893 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.