Protocol 40096: Probe Assay - Adamts4 (2104bpdelEnhancer)-alt1
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  116 bp

Wild Type = 100 bp

>chr1:171262674+171262773 100bp CCAGAACTGCTCGGGTATCT ACTTCTTCAGGGGACACACC

Sequence

Wt Sequence:

 

Mutant Sequence:

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
54494 GAA CAC TGA TAT CCA CAA AGT GTA A Mutant Forward A
54495 ACC CCC AAG TGC TAG GAT TC Mutant Reverse A
54496 Fluorophore-1 ATT GAC TGA TTG ATT GAT TGA ATC C Quencher-1 MUT Probe
55239 CCA GAA CTG CTC GGG TAT CT Wild type Forward A
55240 ACT TCT TCA GGG GAC ACA CC Wild type Reverse A
55241 Fluorophore-2 AGA GAC TTG ACA AAG AAG AGG CA Quencher-2 WT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
54494 0.40 uM
54495 0.40 uM
55239 0.40 uM
55240 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.