Protocol 37656: End Point Analysis Assay - Ptprb (D57N)-EP
Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = A/A
Heterozygote = A/G
Wild type = G/G

>chr10:116277231+116277323 93bp GTTATGGGCTTCTGCAATGG CAGGCACAATCCAGATTTAATG

Sequence

TAAATCAGAAGGTGGTTATGGGCTTCTGCAATGGCAGCAGCCGCAACCAGCAGTGGCTGTCAACTGAG(g/a)ATGGGAAGTTCCTTCACATTAAATCTGGATTGTGCCTGGGTATCTCCAACTCCTCAAGGGGCCCCTTCCA

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
51896 GTT ATG GGC TTC TGC AAT GG Forward A
51897 CAG GCA CAA TCC AGA TTT AAT G Reverse A
51898 Fluorophore-1 TGT CAA CTG AGG ATG GGA AGT T Quencher-1 WT Probe
51899 Fluorophore-2 TGT CAA CTG AGA ATG GGA AGT TC Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
51896 0.40 uM
51897 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
1 95.0 --
2 95.0 --
2 95.0 --
3 60.0 --
3 60.0 -- repeat steps 2-3 for 40 cycles
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.