Stock No: 033846
Protocol 37478: Separated PCR Assay - Fgf21<tm1.1Djm>
Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = ~350 bp
Heterozygote = 566 bp and ~350 bp
Wild type = 566 bp

chr7:45613510-45614075 566bp ACCCCCTGAGCATGGTAGA GCAGAGGCAAGTGATTTTGA

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
51425 ACC CCC TGA GCA TGG TAG A Wild type Forward A
51434 CAG ACC AAG GAG CAC AGA CC Mutant Forward B
51435 GCA GAG GCA AGT GAT TTT GA Common A, B

Reaction A

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTPS-kapa 0.26 mM
51425 0.50 uM
51435 0.50 uM
Glycerol 6.50 %
Dye 1.00 X
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Reaction B

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTPS-kapa 0.26 mM
51434 0.50 uM
51435 0.50 uM
Glycerol 6.50 %
Dye 1.00 X
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Strains Using This Protocol

This is the only strain that uses this protocol.