Protocol 36004: Probe Assay - Cdc5l<em1(IMPC)J>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr17:45426056-45426199 144bp GCTTGTCATTGGGTTTCACC GCTCTGGCACTCTCTCCTTC

Mut= 144 bp

Wt= 144 bp

Fam=Mut

Hex=Wt

Sequence

Wt Sequence (deletion in lower case):

 CACACTCATCTTAGGGGGCAGAGAGAGAGAGAGAGTGTGTGAGTGTGTGTGTTTGTGCACGAGGCCCCATCGCCTGGGCTGCTGAGAGTTTATTAGGACCTTCTTGTTCTGTTCCAGCAGTGTGTTTGTCTGGATGTTCTGCATTTGTGAGGAAGGGCTGCTTGTCATTGGGTTTCACCATGCGTGGAAATACCGAAATTAGAGAATTTTAATGCCGttttattcacgggaagcaattgtaaagatgctgttttccatagtgctcatctgttgtttattttgggaaggagagagtgccagagctagaacttcggtaattctcatactaaatggtgtgatacgggactaactcatctgtgattttttttttcccttcaagggacaaaactgcccaaagggacaatgaagaagaaacaacagatgacccccgaaagcttaagcctggagagatagatccaaacccagagaccaagccagcccggcctgacccgatagacatggatgagggtgagtggatgctggggagtgctcagctcactgtacaggactcaggccttcttggttctcctgtcctgactgttagagacccagttctgtcagtggttattcgaggaggcgtctccccgagtgtgtctgtcagtggttattccatctccccgagtgtgtctggtcctgtttttattagactgTTTTTTTGAGGATGCCCCTTATTTTCTGCTTCTTCATTTCATTTAATGAATCGAGCAGTGAAGTAGGCAGATGTCCTAGAGGCGTGAGCCTCGAAGGATCCTGTCTCATTCCCTTTGTAGAAGGAGAGGCGACAAGCTAGCATGTCGGGCCTTGCTGTTTCTTTGACTTTAGGGTGATTTCCTTTCCAGGAAAGAGCTGTGCTACAAGAGCTGTG

This mutation is a 344 bp deletion beginning at Chromosome 17 position 45,425,670 bp and ending after 45,426,141 bp (GRCm38/mm10).

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
47547 GCT TGT CAT TGG GTT TCA CC Common A
47548 GCT CTG GCA CTC TCT CCT TC Wild type Reverse A
47549 CAC GCC TCT AGG ACA TCT GC Mutant Reverse A
47550 Fluorophore-1 CAC GGG AAG CAA TTG TAA AGA T Quencher-1 WT Probe
47551 Fluorophore-2 CCG TTT TTT TGA GGA TGC C Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
47547 0.40 uM
47548 0.40 uM
47549 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.