Protocol 38207: End Point Analysis Assay - Il34<em1Adiuj>
Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = GA
Heterozygote = AC/GA
Wild type = AC

The WT and Mut Probes (probes 53307 and 53308) anneal over the nucleotide sequence containing mouse genomic variation rs222021297.

Sequence

GTAAACAAAGCCCCATCTTAAAATGGCAGGACTGCGAGCTGCCCAGGCTCCATCCCCACAGTCCGGGGTCCTTGATGCAATGTACAGCTACAAATGTGT(a/g)(c/a)CCTTTGTCTCGGCAGACCCCCACCTCCCTGCCCGGATCCCCAAGCTCAAGCCATGGCTCGTTGCCCTGAGCAATCTATGTATTGACCCTGGGTCGGGCCACTG

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
53305 GGG GTC CTT GAT GCA ATG T Forward A
53306 GAT TGC TCA GGG CAA CGA G Reverse A
53307 Fluorophore-1 CTA CAA ATG TGT ACC CTT TGT CTC G Quencher-1 WT Probe
53308 Fluorophore-2 TAC AAA TGT GTG ACC TTT GTC TCG Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
53305 0.40 uM
53306 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.