For in-depth product & services help, ask our
Technical Information Scientists
Protocol 38207: End Point Analysis Assay - Il34<em1Adiuj>
Version 1.0
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant = GA
Heterozygote = AC/GA
Wild type = AC
The WT and Mut Probes (probes 53307 and 53308) anneal over the nucleotide sequence containing mouse genomic variation rs222021297.
Sequence
GTAAACAAAGCCCCATCTTAAAATGGCAGGACTGCGAGCTGCCCAGGCTCCATCCCCACAGTCCGGGGTCCTTGATGCAATGTACAGCTACAAATGTGT(a/g)(c/a)CCTTTGTCTCGGCAGACCCCCACCTCCCTGCCCGGATCCCCAAGCTCAAGCCATGGCTCGTTGCCCTGAGCAATCTATGTATTGACCCTGGGTCGGGCCACTG
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 53305 | GGG GTC CTT GAT GCA ATG T | Forward | A | |||
| 53306 | GAT TGC TCA GGG CAA CGA G | Reverse | A | |||
| 53307 | Fluorophore-1 | CTA CAA ATG TGT ACC CTT TGT CTC G | Quencher-1 | WT Probe | ||
| 53308 | Fluorophore-2 | TAC AAA TGT GTG ACC TTT GTC TCG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 53305 | 0.40 uM |
| 53306 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.