Protocol 35545: Probe Assay - Orc2<em1(IMPC)J>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr1:58493780-58493931 152bp AAAAACATTCTGGGAAGACATC TGTGATCAACAGAGAGCAAAGT

Mut= 147 bp

Wt= 152 bp

Fam=Mut

Hex=Wt

Sequence

Wt Sequence (deletion in lower case):

 GCAGAAGGATTTCTGAGTTTGAGGCCAGCCTGGTCTACAGAGTGAGTTCCAGGTCAGCCAGGGCTACACAGAGAAATCCTGTCTGGAAAAAAACAAAAAAAACAAACAAAAAAGATAAAAACATTCTGGGAAGACATCTTAACGGCTTTTTTTAAAAGTTGTACTCTTAATGTAggtaggtttatatacctttctgataaaagtagtacaggtgtttgttttaaggagttcatataagtgaaagctactttgctctctgttgatcacaaaagtgcttttatttttccccgattacagctttagaactagcaaaaacatcaggaaaaaaggatccacttgactcaaatgatcctgaaatcacaaaaaacattgctcaaaaaagtaaaggtaagataccatcaggtgatctgtgtgtgctacttttttttccttaaatctaagtgaatttccatgtattttttttgttttcagaaaatgtatttaacagaatgcaatttttgttttgttttgttttgttttgggtttttttggtgttttcaagacagggtttctctgtatagccctggctgtcctggaactcactctgtagaccaggctggcctcaaactcagaaatccgcctgcctctgcctcccgagtgctgggattaaaggcgttgccatcactgcctggccagaatgcaatttttaatatatctatacatatcagtcaataaagggcagaaagtcatctgtgccaccctatgttgggagaattgacgaggaaacctaaaacaatcatcaagtcctataatcatttgtctgagttagccagtttctcatgcaaggtttggaagttgaatggcttgttgcaaattgcagagcatctatttttgaattacccattccagataagagagacagtgtgctttctggtccaaatgaaaaaggctcggggttttgcttccctgttagaatgccacagaaattcaagaatgctgaaaatgttgccactggttagagtagccatataattcttggtgaccatttagcctgtagttaaatggaaactcagtacaatacagtggcttgagtgtaaaacgtgcagctttgctggcaacaaaactatgtcatgatctaagatgaaatatttgtagtaaatgtgacctttgttccgtttagggcattctacttcagagaaagctccactggtggtaagtaactgacaaaacaagcaagtgtgataaatggtagctttctgtcttcgtttcagtgttaaagtttgtgccagttatatacctgttatctgaggttcataaaggacagatgacttacagagtacctcacttggaataaaactggagaatgaaccctggtttcccCTACATagctgttctctgctcttcctgctccttcacagctatcctgcgtatttgtaacttagtagacctgacctcggaatTTGATGAGTTTGGTTTTGTATTTATAATGTTCTCTTCTTAGAGTATTTCGTCCATTAAAGTCTATATTGGCTTGGGTAGGTTCATTCCAGTTTAGCCAAAAGTAATCCACAGTTTTTGTCTCCTTTGTGTTGTAGTGATTTTG

This mutation is a 1259 bp deletion beginning at Chromosome 1 position 58,492,609 bp. There is a 6 bp endogenous retention (CTACAT) after 58,493,784 followed by 74 bp of the deletion and ending after 58,493,873 bp (GRCm38/mm10).

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
46346 AAA AAC ATT CTG GGA AGA CAT C Common A
46348 TGT GAT CAA CAG AGA GCA AAG T Wild type Reverse A
46349 GAA CCT ACC CAA GCC AAT ATA GA Mutant Reverse A
46351 Fluorophore-1 AGT AGT ACA GGT GTT TGT TTT AAG GAG TTC Quencher-1 WT Probe
46352 Fluorophore-2 CTC TTA ATG TAC TAC ATT TGA TGA GTT TGG Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
46346 0.40 uM
46348 0.40 uM
46349 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.