Protocol 35401: Probe Assay - Kctd5<em1(IMPC)J>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr17:24059509-24059603 95bp CGGTATCCTTCCTCCGTGT TTCTCAGCACTCAGCATAGGAC

Mutant=  95 bp

Wild Type = 92 bp

Sequence

TGCAGTGTCTGTGGCTGAGACACTTGCTGGAGAGTATGGCTTCCACACTGTGCTGGCATCTTCCAGTTCTCAACAGAAAGAGCCAGTAGCACAAACAGGCACCTTCCAAGCTGCAGAAAAAAATGTGTCAGTTATCTCCCAGTATCTGTGGGCTGAGACCCGGTATCCTTCCTCCGTGTGTCACCTGTAGtgaccgtccgtaagtatgtctagtgaactgcctggcattttcagtcctatgctgagtgctgagaactgaaaggtctgtgaggatgttaggttaagcctgacacaagaacctcaggttagaggcagggtgtggggactaggggcgtacctgctttggtctgatctagaagaagctcaggttagagacagggtgtggggatcagggacgtatctgctttggtctgatctagaagaagtcactttttttaacctctatttcaggagtgttggaagaagcagaattttacaatatcacctcactaataaaacttgtaaaggacaaaattagagaacgagacagcaaaatatcccaggtgagatgggtgactaatctgcctgtagcttctgggcttgctgtataagcaggtgtggcttctctgtgtgtgaccttggaccagaactgtcctatccccatcctggagccccaggccttgctcccttcctcatctgccatgtctgccatgaagggccatcagtggagataggcagttctgtggaagttgtgtgatgagtgcacagaggagaaggaggcctgctggggagagTGAAGATGCTGGAGAGCAGAGGCTCTGATGGGAGAATATCAAGACCTGATCTGCCAGTGCAAAGGCCCATGGCCAGCACAGCAGAGAGGAGAGCATCGAGGAGCTGGGAAGTAGGTGGCACAGATACTGGGCATCTGTGCAGTCACTGGGAGGAGGTGGGCTTCCCGGGACCTCTGCTGCCCAGCATGTGTGTGTGTTGTGAGTGC

A 583 bp deletion beginning at Chromosome 17 position 24,058,991 bp and ending after 24,059,573 bp (GRCm38/mm10).

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
45965 CGG TAT CCT TCC TCC GTG T Common A
45966 TTC TCA GCA CTC AGC ATA GGA C Wild type Reverse A
45967 TTG CAC TGG CAG ATC AGG T Mutant Reverse A
45968 Fluorophore-1 ACC GTC CGT AAG TAT GTC TAG TGA AC Quencher-1 WT Probe
45969 Fluorophore-2 CCT GTA GTG AAG ATG CTG GAG AG Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
45965 0.40 uM
45966 0.40 uM
45967 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.