Stock No: 033013
Protocol 33278: Probe Assay - App<em1Adiuj>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mut= 98 bp

Wt= 98 bp

Sequence

Wt Sequence (bp changes in brackets with wt first):

 

CTGGGCTGACAAACATCAAGACGGAAGAGATCTCGGAAGTGAAGATGGATGCAGAATTC(G/C)GACATGATTCAGGAT(T/A)TGAAGTCC(GC/AT)CATCAAAAACTGGTAGGCAAAAATAAACTGCCTCTCCCCGAGATTGCGTCTGGCCAGATGAAAT

G601R, F606Y, R609H

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
40451 TCG GAA GTG AAG ATG GAT GC Forward A
40452 ATC TCG GGG AGA GGC AGT Reverse A
41036 Fluorophore-1 TGC AGA ATT CGG ACA TGA TTC A Quencher-1 WT Probe
41037 Fluorophore-2 TGC AGA ATT CCG ACA TGA TTC A Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
40451 0.40 uM
40452 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
034455 B6(SJL)-Apoeem2(APOE*)Adiuj Appem1Adiuj/J
034415 B6(SJL)-Apoetm1.1(APOE*4)Adiuj Appem1Adiuj/J
034454 B6(SJL)-Apoetm1.1(APOE*4)Adiuj Plcg2em3Adiuj Appem1Adiuj Trem2em1Adiuj/J
033868 B6.Cg-Adamts4em1Adiuj Apoetm1.1(APOE*4)Adiuj Appem1Adiuj Trem2em1Adiuj/J
033873 B6.Cg-Apoetm1.1(APOE*4)Adiuj Appem1Adiuj Cd2apem1Adiuj Trem2em1Adiuj/J
033869 B6.Cg-Apoetm1.1(APOE*4)Adiuj Appem1Adiuj Trem2em1Adiuj Bin1em1Adiuj/J
030670 B6.Cg-Apoetm1.1(APOE*4)Adiuj Appem1Adiuj Trem2em1Adiuj/J
033541 B6.Cg-Apoetm1.1(APOE*4)Adiuj Il34em1Adiuj Appem1Adiuj Trem2em1Adiuj/J
033913 B6.Cg-Apoetm1.1(APOE*4)Adiuj Ptk2bem1Adiuj Appem1Adiuj Trem2em1Adiuj/J
033867 B6.Cg-Apoetm1.1(APOE*4)Adiuj Ptprbem1Adiuj Appem1Adiuj Trem2em1Adiuj/J
032775 B6.Cg-Apoetm1.1(APOE*4)Adiuj Scimpem1Adiuj Appem1Adiuj Trem2em1Adiuj/J
033013 B6.Cg-Appem1Adiuj/J
033875 B6.Cg-Epha1em1Adiuj Apoetm1.1(APOE*4)Adiuj Appem1Adiuj Trem2em1Adiuj/J
13 strains use this protocol