Protocol 35163: Probe Assay - Spc25<em1(IMPC)J> Alternate1
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  89 bp

Wild Type = 120 bp

>chr2:69199149-69199268 120bp TGTGTGTGTTTGTGTGAGTGC AAGCCCGATGACCTGAGT

Sequence

Wt Sequence (deletions in lower case; bp changes in brackets with wt first and insertions with carrots ^g^ (g insertion):

CTGGTCCTGACGTTGGCTGACCTTTACCTCAGATTCTCCTGCCCCCAGCTGGAAATGTTGGAATTAAAGTCTGCCTTTATGCTAGCTGAGTTGCTCAATTATTAACCATT[ctgtagcaaagtcaacctgcagacataaactcgaaaatgtggcttatttggtgtcgatagcaactaaaatacagctttgtgctctgttttgcagtgtcttaaaacataatgggtgaagacgaattggcactcttaaatcaaagcatcaatgaatttggggataagttcagaaacag...   ...agtatcctgtctcttgtgcctaagatctgcctcaactgtcatttgactcataaggaaaattgtgtttgcacagctctttccatttcagtgtgtcttcttgaggtaacgacctctaaaggctgagagtgtaattttgccacatagatgtatttggggccctaataagtagcatctctcctgggtgacagaacttcctgggagctaaaactct^agctcccaggaagttctgtcacccaggagagatgctacttattagggccccaaatac^]GAGAACACAGTTCTTTGTATTTCCTGTGCAAATGTGATTACCCTAGAGAACTGGAAATGGTACTGTCAGCAGTTCATGGTTACTTTATGTAAAATAACCAATATGTAGTCATTTACTTTCC

Mutation details

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
44562 CCT TTA TGC TAG CTG AGT TGC TC Mutant Forward A
44563 TGT GTG TGT TTG TGT GAG TGC Wild type Forward A
44564 AAG CCC GAT GAC CTG AGT Wild type Reverse A
44565 Fluorophore-1 CTC CCA GGA AGT TCT GTC ACC C Quencher-1 MUT Probe
44566 Fluorophore-2 CAC CCT TGT GGA GGT CAA AGG T Quencher-2 WT Probe
45430 TGG GGC CCT AAT AAG TAG CA Mutant Reverse A

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
44562 0.40 uM
44563 0.40 uM
44564 0.40 uM
45430 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.