Protocol 38098: Standard PCR Assay - Msra<tm1Jmo>-alternate6
Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = 225 bp
Heterozygote = 172 bp and 225 bp
Wild type = 172 bp

>chr14:64284644-64284815 172bp TTTAGCTTAGCAAACTGGACTGG CCCCATTTCTCAGTCAGTGC

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
52979 TTT AGC TTA GCA AAC TGG ACT GG Wild type Forward A Wt F
52980 CCC CAT TTC TCA GTC AGT GC Common A
oIMR5316 CTA AAG CGC ATG CTC CAG AC Mutant Forward A Mut F

Reaction A

Component Final Concentration
ddH2O
ddH2O
Kapa 2G HS buffer 1.30 X
Kapa 2G HS buffer 1.00
MgCl2 2.60 mM
MgCl2 2.00
dNTP KAPA 0.26 mM
dNTPS-kapa 0.20
52979 0.50 uM
52979 0.50
52980 0.50 uM
52980 0.50
10x Loading Dye 0.50
oIMR5316 0.50 uM
Glycerol 6.50 %
Kapa 2G HS taq polym 0.01
DNA
Dye 1.00 X
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Strains Using This Protocol

This is the only strain that uses this protocol.