Protocol 34339: Probe Assay - 2610507B11Rik<em1(IMPC)J>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr11:78263023+78263123 101bp GAGCTACTTGGAGGACTCTGC CGGCCTCTTGAGAAACAAG

Mut= 102 bp

Wt= 101 bp

Fam=Mut

Hex=Wt

 

Sequence

Wt Sequence (deletion in lower case):

 CCGTAGTTCTGGTTGTTGTGCCTAAATGAGTATGACTAGAGAAATATTTTAGGAAAATCGTAAAGTTCCTAAGAAAAATCCGGCTTCAGGATACCACCCCTTGCAAGGCCTTTCTAGAATCAAAAAGGgtagagggtcttataatccaactgttttttttctgcaggtggcttgtggtccggttggccaccaggtggtgtcagcgcaagttgcaggcagagctaaagattggctccttccgatttttttggatccagaatgtcagtcttaagtttcagcagcaccagcagacggtggtgagttccgggaattgcagagagaaagagagagagagagagagaggagaagggcgggagtgtgtggtgtgtgtgttggtttggagggggtttcaaactttagcttcctccatgggtagttttcctagttaactccacccttgttgttgttgtttttgttgttgttattattattattgtcaagaggatcttaggagctacttggaggactctgcaatagatgccagttgtttcaagtgtttatggGACTAGATCTGGTGGTATAAACCTGTAATTCTTGTTTCTCAAGAGGCCGAAGCAAGAGAATTATAAATTCAAGCTCTGCCTAGGCAACTTAGTGAGTGCTTCTCTCAAAATTAAAATGAGCTGGAATAGTGGTTCAGTGGTA

This mutation is a 414 bp deletion beginning at Chromosome 11 position 78,262,661 bp and ending after 78,263,074 bp (GRCm38/mm10).

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
43348 GAG CTA CTT GGA GGA CTC TGC Wild type Forward A
43349 CGG CCT CTT GAG AAA CAA G Common A
43350 AAA TCC GGC TTC AGG ATA CC Mutant Forward A
43351 Fluorophore-1 AAT AGA TGC CAG TTG TTT CAA GTG T Quencher-1 WT Probe
43352 Fluorophore-2 AGA ATC AAA AAG GGA CTA GAT CTG G Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
43348 0.40 uM
43349 0.40 uM
43350 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.