For in-depth product & services help, ask our
Technical Information Scientists
Protocol 41260: Probe Assay - Il1rap KO Exon3 (573 bp del)-alt1
Version 1.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 88 bp
Wild Type = 83 bp
>chr16:26676915+26676997 83bp CGCATCAGTAAGGAGAAAGATG TACCTCAACATGCAGGTGTAATTG
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 57222 | CGC ATC AGT AAG GAG AAA GAT G | Wild type Forward | A | |||
| 57223 | TAC CTC AAC ATG CAG GTG TAA TTG | Wild type Reverse | A | |||
| 57224 | Fluorophore-1 | CAC CCT CCT CAA TGA CAC G | Quencher-1 | WT Probe | ||
| 57869 | CCA AAA CAC AGA TAG GCA CCA | Mutant Forward | A | |||
| 57870 | CTC TCT GCA TAC CAC CTC CTT C | Mutant Reverse | A | |||
| 57871 | Fluorophore-2 | ACA AAA CTA AAA GAC TGT GGA GAA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 57222 | 0.40 uM |
| 57223 | 0.40 uM |
| 57869 | 0.40 uM |
| 57870 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.