Protocol 41260: Probe Assay - Il1rap KO Exon3 (573 bp del)-alt1
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  88 bp

Wild Type = 83 bp

>chr16:26676915+26676997 83bp CGCATCAGTAAGGAGAAAGATG TACCTCAACATGCAGGTGTAATTG

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
57222 CGC ATC AGT AAG GAG AAA GAT G Wild type Forward A
57223 TAC CTC AAC ATG CAG GTG TAA TTG Wild type Reverse A
57224 Fluorophore-1 CAC CCT CCT CAA TGA CAC G Quencher-1 WT Probe
57869 CCA AAA CAC AGA TAG GCA CCA Mutant Forward A
57870 CTC TCT GCA TAC CAC CTC CTT C Mutant Reverse A
57871 Fluorophore-2 ACA AAA CTA AAA GAC TGT GGA GAA Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
57222 0.40 uM
57223 0.40 uM
57869 0.40 uM
57870 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
1 95.0 --
2 95.0 --
2 95.0 --
3 60.0 -- repeat steps 2-3 for 40 cycles
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.