Protocol 34199: Probe Assay - Crcp<em1(IMPC)J>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr5:130035050+130035150 101bp CCTGATGGAGCTTGGAGTGA GGGATTTTCGGCAGAGTACC

Mut= 110 bp

Wt= 101 bp

Fam=Mut

Hex=Wt

Sequence

Wt Sequence (deletion in lower case):

 AGGGGTTCAGTGCTGTCTTCAGGCTTCTGTGCACACTTAGGCATAAACACACCAGACATACGCATCCGCACACCTGTGTAGTACATTCATATACTCTCATAGGCACAAGCATACACATAAGTAATATTAAAAAAAAAAGGAAAGTTGTCTCTATCTGAAATTGctaaccagggcagaacttaaggcatttctagtttaggttgttcctgagcgagtgagaaagctgggattaactagagggttcatttgtggacacttaaccttgaaatggatgtgaactgatgacggctctctgttcttttgtaggaaggatgcgaacgcagcactgctcagcaactatgaggtgaggacccccacgcgggccattgtgttttcctctctggtttagctttgcttttgaagacgttggattggttttctttagaaacgagagggcaggtggcccctgatggagcttggagtgatatgagtttggtgaactacacatggttcttcagggaagCGGGGAGGCTCTGGTTCACAATAGGTACTCTGCCGAAAATCCCAGAGTCTCTAGAGCAGGCAGATGTCCTAGCAGAAGGCTGCTGCTTTAGAGCGCAGTCCTGCTGTAAAAGTCTCCTATTAAATGCGTAGCTTCTTGATAATAACCATTCTCTACTTGTCTTTGATTCT

This mutation is a 339 bp deletion beginning at Chromosome 5 position 130,034,769 bp and ending after 130,035,107 bp (GRCm38/mm10).

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
43037 CCT GAT GGA GCT TGG AGT GA Wild type Forward A
43038 GGG ATT TTC GGC AGA GTA CC Common A
43039 TCA TAG GCA CAA GCA TAC ACA Mutant Forward A
43040 Fluorophore-1 CTA CAC ATG GTT CTT CAG GGA AG Quencher-1 WT Probe
43041 Fluorophore-2 CTC TAT CTG AAA TTG CGG GG Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
43037 0.40 uM
43038 0.40 uM
43039 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.