Stock No: 032664
Protocol 32638: Probe Assay - Grin2b<em2Lutzy> (5'Loxp)
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mut= 137 bp

Wt= 132 bp

Sequence

Wt Sequence (insertions with carrots ^g^ (g insertion)):

 GACCTTGGCTTCATTCTCCAGTACTATGTGGGCGCTGTTACTAACAGGTATATGCTATCATTGGTTTCCATAG^ATAACTTCGTATAATGTATGCTATACGAAGTTATACTAGT^CTAAGCATCAGGTACATTGTAGATGAATGTCCTTACACCAAAATTCAAAAACATCTTTT

Mutation details

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
39617 Fluorophore-1 TGG TTT CCA TAG CTA AGC ATC AG Quencher-1 WT Probe
39624 ACT ATG TGG GCG CTG TTA CT Common A
39625 ATC TAC AAT GTA CCT GAT GCT TAG ACT Mutant Reverse A
39626 Fluorophore-2 TCA TTG GTT TCC ATA GAT AAC TTC G Quencher-2 MUT Probe
39690 AAA AGA TGT TTT TGA ATT TTG GTG Wild type Reverse A

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
39624 0.40 uM
39625 0.40 uM
39690 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.