For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 032621
Protocol 36719: Standard PCR Assay - Ly6a<tm1.1(cre)Jmol> Alternate1
Version 2.0
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant = 284 bp
Heterozygote = 284 bp and 352 bp
Wild type = 352 bp
>chr15:74827761-74828112 352bp AGAGCCCAGGGATGTGATTG CAAGGCAGGTTCTGACAGGT
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 14314 | CGG TTA TTC AAC TTG CAC CA | Mutant Reverse | A | |||
| 43156 | AGA GCC CAG GGA TGT GAT TG | Common | A | |||
| 43157 | CAA GGC AGG TTC TGA CAG GT | Wild type Reverse | A |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTP KAPA | 0.26 mM |
| 14314 | 0.50 uM |
| 43156 | 0.50 uM |
| 43157 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.
Strains Using This Protocol
This is the only strain that uses this protocol.