Stock No: 032596
Protocol 35778: Standard PCR Assay - Hip1r<tm1Tsr> Alternate2
Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = ~100 bp
Heterozygote = 85 bp and ~100 bp
Wild type = 85 bp

>chr5:123990299+123990383 85bp GCAGTTCTCAGAGTCGGTAGTC GCCTGAGGCCTCTGACTT

 

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
47001 TGC CCT TAG CCA CTC TTC CT Mutant Forward A
47002 GAT CGA GCA TGC ATC TAG ATA CCT Mutant Reverse A
47003 GCA GTT CTC AGA GTC GGT AGT C Wild type Forward A
47004 GCC TGA GGC CTC TGA CTT Wild type Reverse A

Reaction A

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTP KAPA 0.26 mM
47001 0.50 uM
47002 0.50 uM
47003 0.50 uM
47004 0.50 uM
Glycerol 6.50 %
Dye 1.00 X
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Strains Using This Protocol

This is the only strain that uses this protocol.