For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
Mutant= 119 bp
Wild Type = 108 bp
>chr6:124822637-124822744 108bp ATCCTTGGGGATGGTGTGT GCTATCCAAGGTCAGGGTCAG
Wt Sequence: atccttggggatggtgtgtgatgcaggtactctgcttcctctacagTGACCTTCAGTCCGggTACCAGCCTGTTGCAAGGGCAGAGCCTGACCCTGACCTTGGATAGC
Mutant Sequence: gtgttgggtcgtttgttcggatccgtcgactagaGTACCAGCCTGTTGCAAGGGCAGAGCCTGACCCTGACCTTGGATAGC
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
33568 | Fluorophore-1 | CTG CTT CCT CTA CAG TGA CCT TC | Quencher-1 | WT Probe | ||
33569 | ATC CTT GGG GAT GGT GTG T | Wild type Forward | A | |||
35069 | GCT ATC CAA GGT CAG GGT CAG | Common | A | |||
35070 | Fluorophore-2 | TCG TTT GTT CGG ATC CGT C | Quencher-2 | MUT Probe | ||
oIMR8394 | AGG GGA TCG GCA ATA AAA AG | Mutant Forward | A |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
33569 | 0.40 uM |
35069 | 0.40 uM |
oIMR8394 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |