Protocol 30773: Probe Assay - Rag1<tm1Mom> Probe
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr2:101643014-101643119 106bp CGACTCTGCTTTGGTGTCTG CACCACTGTGAAGGGACCA

Mutant=  110 bp

Wild Type = 106 bp

Sequence

Wt Sequence: CGACTCTGCTTTGGTGTCTGCTTTGATGGACATGGAAGAAGACATCTTGGAAGGCATGAGATCCCAAgatcttgatgactacctgaatggtcccttcacagtggtg

 

Mutant Sequence: ctaaagcgcatgctccagactgccttgggaaaagcgcctcccctacccggtagaattcctgcagcccggggGATCTTGATGACTACCTGAATGGTCCCTTCACAGTGGTG

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
35458 Fluorophore-1 CAT CTT GGA AGG CAT GAG ATC Quencher-1 WT Probe
35459 CGA CTC TGC TTT GGT GTC TG Wild type Forward A
35460 CAC CAC TGT GAA GGG ACC A Common A
35461 Fluorophore-2 TGG GAA AAG CGC CTC C Quencher-2 MUT Probe
oIMR5316 CTA AAG CGC ATG CTC CAG AC Mutant Reverse A

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
35459 0.40 uM
35460 0.40 uM
oIMR5316 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
032088 B6.129S-Rag1tm1Mom Cd47tm1Fpl Il2rgtm1Wjl/SzJ
032562 FVB.129S7(B6)-Rag1tm1Mom/LcsnJ
018454 NOD.Cg-Rag1tm1Mom Fahem1Mvw Il2rgtm1Wjl/MvwJ
033127 NOD.Cg-Rag1tm1Mom Flt3tm1Irl Mcph1Tg(HLA-A2.1)1Enge Il2rgtm1Wjl/J
030533 NOD.Cg-Rag1tm1Mom Il2rgtm1Wjl Tg(SLC10A1)15Mvw/MvwJ
026014 NOD.Cg-Rag1tm1Mom KitW-41J Il2rgtm1Wjl/EavJ
007799 NOD.Cg-Rag1tm1Mom Il2rgtm1Wjl/SzJ
014568 NOD.Cg-Rag1tm1Mom Ins2Akita Il2rgtm1Wjl/SzJ
006303 NOD.FVB-Tg(TcraBDC12-4.1)10Jos/GseJ
006770 STOCK Rag1tm1Mom Tg(TIE2GFP)287Sato/J
10 strains use this protocol