Stock No: 032487
Protocol 36753: Probe Assay - Crbn<tm1.1Ble> Probe
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  105 bp

Wild Type = 105 bp

>chr6:106781062-106781166 105bp GCCTAGTACAAAGGCTAAAAATAGG TCCAATATGGCTTGCACAGA

Sequence

Sequence: aacagcaacatatagacacgtgcagtaataaattatccagttataacagggtggctttgtaaatttgaggtgtcagagaaatctcacgagaagcctagtacaaaggctaaaaataggttttaacttatatctttccttcattttatagGTATGCATGGACC(A/G)t(t/g)GCCCAGTGCAAGATCTGTGCAAGCCATATTGGATGGAAATTTACAGCCACAAAAAAAGACATGTCACCTCAAAAATTTTGGGGCTTAACTCGCTCTGCTCTGTTACCCACAATTCCAGAGACTGAAGATGAAATAAGTCCAGACAAAGTAATACTTTGTTTATAAGTGCACCTGTAGGAGT

 

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
49562 GCC TAG TAC AAA GGC TAA AAA TAG G Forward A
49563 TCC AAT ATG GCT TGC ACA GA Reverse A
49564 Fluorophore-1 CAT GGA CCA TTG CCC AGT GC Quencher-1 WT Probe
49565 Fluorophore-2 CAT GGA CCG TGG CCC AGT G Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
49562 0.40 uM
49563 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.