Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr12:100499929-100500066 138bp GCCACAGGGACCAAGAAGT CCGAGGGTGGATACACTGA
Mut= 152 bp
Wt= 138 bp
Fam=Mut
Hex=Wt
Wt Sequence (deletion in lower case; and insertion with carrots ^g^ (A insertion):
CTTCTCTTGCAAATAGACAGCATTGGACTTTATGTGTATTTCACAAGATCATCATATGTTTTACCATTACAGGAGAATTTCTTTACTCCCTTCTGATCTTAAATTTCCAAATTAATATGTAACCATCTTGGAGTCCA^taactatgtggcaaagaaatgacttagcgcttgagccaacactgctggaatgttccctgctaaagagcactctctcacatagacacaatcttgggttctaaaggttccagaagagcctcgccagaaacccggaagcttagtgcatgtggggcgtgaggtcctcggggcgtgaggtgctcagggctttcctgcacacagaccgtttcttattcatttatcgtctcacttggttctgcagatgatatggctgaacttctccttggggagtcgaaactggaacagcacttgaaggagaagcccctgcggcagggagccagtccccggggccccagaccccagctgactgaagtgcgcaagcatctgaccgctgccctggaccgagggaacctcaaggtactgtgtgccacagggaccaagaagtgatggtagtgggtactgccatcatctcctagggacagtgtggtgagcaaggtgtgtttggcgcacacgtgtcttctttagcaggcacacgccctgcct^GATCAGTGTATCCACCCTCGGCTGGCTGGCCTGTGGGGCTCCCAGCCTAGTAGGAGTCTCTGATGGGAGTCTGCAATAACACATTCAACAGAACGAGGGGTTCATTTCCCCCCAGGCACTT
This mutation is a 519 bp deletion beginning at Chromosome 12 position 100,499,950 bp and ending after 100,500,468 bp (GRCm38/mm10). There is also a single bp insertion (A) at the deletion site that will not alter the results of the deletion.
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
41640 | GCC ACA GGG ACC AAG AAG T | Wild type Forward | A | |||
41641 | CCG AGG GTG GAT ACA CTG A | Common | A | |||
41642 | TGC AAA TAG ACA GCA TTG GA | Mutant Forward | A | |||
41643 | Fluorophore-1 | TAG CAG GCA CAC GCC C | Quencher-1 | WT Probe | ||
41644 | Fluorophore-2 | TGT AAC CAT CTT GGA GTC CAA GA | Quencher-2 | MUT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
41640 | 0.40 uM |
41641 | 0.40 uM |
41642 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |