Protocol 33527: Probe Assay - Hspd1<em1(IMPC)J>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr1:55084911-55085025 115bp TCTGGGATTTGGCGATTAAC CACTGATCATTTGCCAGGAG

Mut= 117 bp

Wt= 115 bp

Fam=Mut

Hex=Wt

Sequence

Wt Sequence (deletions in lower case;  and insertions with carrots ^g^ (G at first insertion, GTCTC at second):

TCAGAAAACAAAATAAACCTAGGTCATAGCCAAAACTCAAGTGCAAATGATGTGAAGAGTGTTCTGGGATTTGGCGATTAACATCTGTGCTTTCTTGTTTTATGGGTGGCATCTGTTA^gtaccagggaattcctgttgtgcttcattcaatgttggactcctggcaaatgatcagtgctcattttttatagacctaagatggttgattaacgtggctttgagattcatgttgcaggatggttaaaaatgacaaatttgagggttatcattgagggttgctttttttttccctgtcgctgtagggaagaactgtgattattgaacagagttggggaagtcccaaagtaacaaaagatggggtcactgttgcaaagtcaattgatttaaaggataaatacaaaaatattggagctaaacttgttcaggacgttgccaataacacaaacgaagaggctggggatggcaccaccactgccactgttctggcacgatctattgccaaggagggctttgagaagatcagcaaaggggctaatccagtggaaatccggagaggtaagagtatatcattgatcttatcctgtaaa^GAATTCTGTTGTCTTTATCTTTGTCCTTT^ttat^TACATTCGTTGTAGAGTTTGTGAGTGTTCATTCTTGGTGGAATTGCCCTTTCCTTACTTATGTGGGTTTCCAA

This mutation is a 469 bp deletion beginning at Chromosome 1 position 55,084,501 bp and ending after 55,084,969 bp (GRCm38/mm10).  In addition, there is a single bp insertion (G) at the deletion site as well as an indel with a 5 bp insert (GTCTC) and 4 bp deletion (TTAT) 29 bp after the 469 bp deletion that will not alter the results of the deletion. 

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
41612 TCT GGG ATT TGG CGA TTA AC Common A
41613 CAC TGA TCA TTT GCC AGG AG Wild type Reverse A
41614 CAC TCA CAA ACT CTA CAA CGA ATG Mutant Reverse A
41615 Fluorophore-1 CCT GTT GTG CTT CAT TCA ATG T Quencher-1 WT Probe
41616 Fluorophore-2 TGG CAT CTG TTA GGA ATT CTG TT Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
41612 0.40 uM
41613 0.40 uM
41614 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.