Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr7:144510166-144510252 87bp AGCTCTGTGGGTATGCAAGG GTCACATCACTGGGCACCTC
Mut= 104 bp
Wt= 87 bp
Fam=Mut
Hex=Wt
Wt Sequence (deletion in lower case and insertion with carrots ^g^ (TGTCTGCTTTGTTACAGAACCCAGTGCTACTAGATTGCCCCCTGTGGCTGGATCT insertion):
ATCTCTGCAACCCTAGGTCCTTGGGTGATCTGTTTGAGACTAATAGCATGGGTTTCTTGTAAGAGACAGGGCCAGCTGGGATCTCTGTGTGGGTTGGGGTGGAAGATAATAAGGACTGGCAGCCTGTGGGCTAGGACAGGTGGGCCATTTATACAGTTTTTACACCCTGGCCTTGCCC^ccttttaacttgtctatcaccaggagtactgcttttcatttactagggcatccatcgatttggagacccaagttctgcttactctaggactcaggaagtgttctcagaattgaaacgcatcttataggggccgagtccatgtgagagagttgccatggaagctgtttattgttttctaggaccaacttgtcgtgactattgaagccctgaaggctgagctggagcagatgagactgagaggtccttcactccatcatgggtatggcggtcacagatggactaggtttcagctctgtgggtatgcaagggcttgctgctgtctctgcgggc^GTGGGAAGAGGCCTCTGTGCTGACTGAGGTGCCCAGTGATGTGACAGAAGAGAGAACATAATGGGAGCAGAAGGACAGGCCTCATAGAAGAGTCCCACTGCAGGAGGGAGTGCCATGGGCAGCTGCTCAGAGTCCATTTCATAGCTTCGGT
This mutation is a 330 bp deletion beginning at Chromosome 7 position 144,510,211 bp and ending after 144,510,540 bp (GRCm38/mm10). In addition, a 55 bp sequence corresponding to Chr 7:144512416-144512470, from the upstream intron between exons 11 and 12, and inserted into the deletion site.
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
41326 | AGC TCT GTG GGT ATG CAA GG | Wild type Forward | A | |||
41327 | GTC ACA TCA CTG GGC ACC TC | Common | A | |||
41328 | GCC CTG TCT GCT TTG TTA CAG | Mutant Forward | A | |||
41329 | Fluorophore-1 | CTT GCT GCT GTC TCT GCG | Quencher-1 | WT Probe | ||
41330 | Fluorophore-2 | TGG CTG GAT CTG TGG GA | Quencher-2 | MUT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
41326 | 0.40 uM |
41327 | 0.40 uM |
41328 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |