Protocol 33365: Probe Assay - Sec62<em1(IMPC)J>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr3:30800786+30800909 124bp TACCGTTGAGGGAAGAAGGA CTGATAAGCATCTTCACAGCAAG

Mut= 122 bp

Wt= 124 bp

Fam=Mut

Hex=Wt

Sequence

Wt Sequence (deletion in lower case):

 CTAATCTCTAAATCGAATGTATTTCTTTGCTAGTATAGCAGTAGGTTGTTCAGAGTGATTCTTTAGTGGTTATAATAACACGAGCATTTTCATTACCGTTGAGGGAAGAAGGAAGTGTTTGAGGTTATTTTTTTGTTGATTATTCAgagattgatggttaacaaatgtttatcttgcttgaataataatatttacttgctgtgaagatgcttatcagtatactcacagttgacataaataacattatagtcaatagacttgatattctgttttattttctgttgtcagaatgttgacatttatagcatgatttcataagacgtaagttcatgaatactaaattttaaataaccaatttcttgtatagcttcaaaagcagtggagtgcctcttggattcaaagtgggccaaggccaagaaaggagaggacgctttatttacaaccagggagtctgtggtcgactactgcaacaggtagcgttccttggtgaaggataacaattagcaataccagttttttccatagtgttgaaactgtttaactaaatgtaatgagctttatatgtaacttggatttttcagtagaaatatctttgttcttaaacttactatatttttagttgtgtatgtatactttgtagttatgttcttttacttgtgtgtatttaccagagctactgaatgGAAGAATCAAGATTTTAAAAAGGATAAACATGTCTACATTGAACAAATTCTGTGTAGGAAATGGTCAGGATTTTTTTTCCAGATCTTTTATAGGATGACGGTTAACTTCATTATCCTTTGGTTTTTAATGGCTTTGCCCTGGGCTATAAGCCTAACTTACTTGCTGTTTT

This mutation is a 537 bp deletion beginning at Chromosome 3 position 30,800,839 bp and ending after 30,801,375 bp (GRCm38/mm10).

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
41242 TAC CGT TGA GGG AAG AAG GA Common A
41243 CTG ATA AGC ATC TTC ACA GCA AG Wild type Reverse A
41244 CCT GAC CAT TTC CTA CAC AGA Mutant Reverse A
41245 Fluorophore-1 TGA TGG TTA ACA AAT GTT TAT CTT GC Quencher-1 WT Probe
41246 Fluorophore-2 TTG TTG ATT ATT CAG AAG AAT CAA GAT T Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
41242 0.40 uM
41243 0.40 uM
41244 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.