Protocol 33236: Probe Assay - Slc39a10<em1(IMPC)J>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr1:46832399-46832571 173bp AATATAGGGGCATCGGGTAA TCTTGGCGTCTTCCAATATC

Mut= 164 bp

Wt= 173 bp

Fam=Mut

Hex=Wt

Sequence

Wt Sequence (deletion in lower case:

 TGCTCTTATGATAATCAAACTCATTGAACTAAATGTGCCCCAGCATTCAATAAAACATTTCTTCTGCAATGCCTTTGGCAGGAAAAAATATATGTGCTAATGGATTTTGAGTCACTGATACTGCAGTTTGGtaaggcagagcccttctgatcctgtatgaatcttgggaacatggttgagtcatatttcatgtgttggaataggaaaaagaactctagaaattctctagtaatctagtagtatatctccctattttaattttttgcataaattcctatggaaagcatggctcttatgtgtttgtattacagtatttcaagtgatatttagagtattttaattgtacaataatattttctgcataatcttaaaaacctgcttatactcagtttgttttatccgtttccttgcagtgtttgaacgtcactcagttgttaaaacactttggtcttggtccgaactctcccatctcaccggatctattcacgtacctttgccctgcattgctgtatcagatcgacagcagactttgtattgaacattttgacaaacttttagttgaagatttaaataaggataaaactctggttcctgaagataagacaaatataggggcatcgggtaagaaagacttttttcctctttaaggtagTACTCATACTGTCCCTTAAATTATTTATTAAAAAGAAAGACTAAATTGTTAGTTTCATTTCAGTGTCAGATTTTAATGATCCAATCAGATTTAGATATCTATATAAGATATTGGAAGACGCCAAGAGGCTTATTAGTATTTTTATTTTATTTCCTCTGGCCCTG^TAGAGGAGTGTTTTGTTGAAAACAGAGAAAAAGATTAAAAAGGAAATAGAAATCTTTTTGACAATCAGCCATAAAATGGGAACTCTGATTAAAGTT

This mutation is a 521 bp deletion beginning at Chromosome 1 position 46,832,525 bp and ending after 46,833,045 bp (GRCm38/mm10). In addition, there is a single bp (A) insertion 164 bp after the exon deletion that will not alter the results of the exon deletion

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
40956 AAT ATA GGG GCA TCG GGT AA Wild type Forward A
40957 TCT TGG CGT CTT CCA ATA TC Common A
40958 GTG CTA ATG GAT TTT GAG TCA CTG Mutant Forward A
40959 Fluorophore-1 TAA GAA AGA CTT TTT TCC TCT TTA AGG TAG Quencher-1 WT Probe
40960 Fluorophore-2 TGC AGT TTG GTA CTC ATA CTG TCC Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
40956 0.40 uM
40957 0.40 uM
40958 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.