Protocol 33155: Probe Assay - Ints7<em1(IMPC)J>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr1:191582471+191582610 140bp CGTTCCCTATCCTCATCAACTC TGGACCAGAAGAAAAGACACAG

Mut= 140 bp

Wt= 140 bp

Fam=Mut

Hex=Wt

Sequence

Wt Sequence (deletion in lower case):

CATCAGATCTCATTACAGATGGTTGTGAGCCATGTGGTTGTTGGGACTTGGAACTTAGGACCTTTGGAAGAGCAGTCAGTGCTCTTAACCACTAAGCCATCTCTCCAGTTCCTTGAACAGTGCTTCTTTTTACTTGTTGAAAACTTGCTgtcctcctgtataagttagtatttgacatttctgtaagttagcttctgtcagtatttgacatatctgtaattagttcctcctgtgctttttcaataggactgaggtctggcaaactcggggagcagtgtgaggcagtcgtgcgctttcccaggcttttccagaagtacccgttccctatcctcatcaactcagcattcctaaagttagctgatgttttcagagttgggtaagtgtgctgaatgcctcagcagcccaaaggacaggctacttgtatctctgttttatactgtgtcttttcttctggtccattagaacttcttgccactcagttactctcggtgaatgcataatgctttgtaccatactttaatatgagatttaatgacacttttagaaaaaatgaaaaggttcagagcgaaattgtttcttcagggaacaagataaattaagtcagaacagccttattctgctactgtatatgtattttgtaaaattgtaggctttcttacagatgGTTTTAGAAATTCCTGATTTCATTTAGTGACTTGTAGGTACAGTCTTGGAGATGTGTATGCTCCTTACCCTTATCTCTTCTAAGCTGTGTGGAGGAAGATCGCCTGACTCACTGGCTGTCGCCT

This mutation is a 515 bp deletion beginning at Chromosome 1 position 191,582,302 bp and ending after 191,582,816 bp (GRCm38/mm10).

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
40769 CGT TCC CTA TCC TCA TCA ACT C Wild type Forward A
40770 TGG ACC AGA AGA AAA GAC ACA G Wild type Reverse A
40771 CCA GTT CCT TGA ACA GTG CTT Mutant Forward A
40772 CCT CCA CAC AGC TTA GAA GAG A Mutant Reverse A
40773 Fluorophore-1 CAG AGT TGG GTA AGT GTG CTG A Quencher-1 WT Probe
40774 Fluorophore-2 TGT TGA AAA CTT GCT GTT TTA GAA AT Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
40769 0.40 uM
40770 0.40 uM
40771 0.40 uM
40772 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.