Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr10:128380453+128380544 92bp CCCTCAATGTTGCAAACACA GCCCTCAACCTACCAAAGTACA
Mut= 87 bp
Wt= 92 bp
Fam=Mut
Hex=Wt
Wt Sequence (deletions in lower case; and insertion with carrots ^g^ (GTCC insertion):
GGCAGAGGCAGGCGGATTTCTGAGTTCGAGGCCAGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTACATAGAGAAACCCTGTCTCGAAAAAACAAACAAACAAACAAAAGAACAGAGGTATCAGCTGTCACCCTCAATGTTGCAAACACAAAGGGGGAAGATTCTGAGTGCACCTCTCTT^ttcaggaggtcagaggcatctgtactttggtaggttgagggcatgaacctgttccgtgtcttttatatcctcatatagacagtgaacctgctcctgaataagggagccagcctgaatgtctgcgataaaaaggaacggcagccgctgcactgggcagcttttctaggtgagagacactgtaggaaaagggagaatttgattgttaggatccccagggcaagtttcaccctttggggg^TGGAGCCTGGAGCCTTTGGGGGAGGAGCCTAGAGCCTTTGGGGAGGGAGCCTGGGGCCtttgggggtggagcttagggcctttgggtttacCCTCCACCTGCTTGCTTCTCCTTCCTTCCTTTCCTTCTTCCTTCCTTTCCTTTCCTCCCTCCTTCCGTTTCTCATTCCTTCCTTTTTTTCTTCATAGGGCATTTAGAGGTCCTGAAACTGCTGGTGGCACGTGGAGCA
This mutation is a 237 bp deletion beginning at Chromosome 10 position 128,380,503 bp and ending after 128,380,739 bp (GRCm38/mm10). In addition, there is a 33 bp deletion (TTTGGGGGTGGAGCTTAGGGCCTTTGGGTTTAC) 58 bp after the exon deletion and a 4 bp insertion (GTCC) at the exon deletion site, that will not alter the results of the exon deletion.
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
40836 | CCC TCA ATG TTG CAA ACA CA | Common | A | |||
40837 | GCC CTC AAC CTA CCA AAG TAC A | Wild type Reverse | A | |||
40839 | TCT AGG CTC CTC CCC CAA A | Mutant Reverse | A | |||
40841 | Fluorophore-1 | TTC AGG AGG TCA GAG GCA TC | Quencher-1 | WT Probe | ||
40842 | Fluorophore-2 | CCT CTC TTG TCC TGG AGC CT | Quencher-2 | MUT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
40836 | 0.40 uM |
40837 | 0.40 uM |
40839 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |