Stock No: 032173
Protocol 35807: Probe Assay - Esr1<tm4.1Ksk> Probe
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  91 bp

Wild Type = 104 bp

>chr10:4746842+4746945 104bp TGCCCTAAAAACAGCAGAGA TCAACCAAGGAGAACAGAGAGAC

Sequence

Wt Sequence: aatagtgtattgtctaaaaactgctctgtttatgccctaaaaacagcagagaacagaaaggaagacaaggtctttgtacagCGctatttgcacaacacatgaatatctagtaagtctctctgttctccttggttgaaacttggaaaagacacagactcccAGGagaagtggtaatgccagggaagctgtggctaagaatttctgcttccccct

 

Mutant Sequence: TAGTGTATTGTCTAAAAACTGCTCTGTTTATGCCCTAAAAACAGCAGAGAACAGAAAGGAAGACAAGGTCTTTGTACAGCcgcgccgattggccagtactagtgaacctcttcgagggacctaATAACTTCGTATAGCATACATTATACGAAGTTatattaagggttattgaatatgatcggaattatcagatctctagatccgcggtcgacatatgagcgctaagcttgacgtcaccggttctagaacctagGCTATTTGCACAACACATGAATATCTAGTAAGTCTCT

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
37084 TGC CCT AAA AAC AGC AGA GA Common A
47074 GGT CCC TCG AAG AGG TTC A Mutant Reverse A
47075 TCA ACC AAG GAG AAC AGA GAG AC Wild type Reverse A
47076 Fluorophore-1 CTT TGT ACA GCC GCG CCG A Quencher-1 MUT Probe
47081 Fluorophore-2 CTT TGT ACA GCG CTA TTT GCA CAA C Quencher-2 WT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
37084 0.40 uM
47074 0.40 uM
47075 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.