Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr7:127589872+127589968 97bp CAGACCCAGGGACATCAGA CCCCACATCAAAGTCACCTC
Mut= 100 bp
Wt= 97 bp
Fam=Mut
Hex=Wt
Wt Sequence (deletions in lower case; and insertions with carrots ^g^ (CAT and CACATCA insertion):
TACACAAACCGGGTGGTGAGGGTGGGTGTGCCAACGGCGTGAATGTGATCAGAGAACAACTTTACGGAGTCCCTTCTGGCCTTTTACTTATGCGCACATATGTTCCCGTAAGTCCTGTGT^gatgtgtctgagttggaaacaggtaggggcaggaacggaatgtgaagctctcatgactagcatattctctttgcaagtgtctgagccttgctatatacctctcccctttcagtctaatccttgtcctattgtgtgtcagtgatggttcagggtcctgcccgacactctgcctcttcccttctggtaggaggagatggattccaaggtactgcagttcaagaacaagaagctggcggagcggttggagcagcggcaagcctgcgaggatgagctccgggagagaattgagaaattggagaagaggcaggccactgatgatgccacactcctcatcgtcaaccgctactgggcccaggtggatgcctgaagagcgagcgtcctactgggagaagccctgaggcattcctaacctcttgttctttcttctttcagctggatgaaactgtagaagccctcctccagtgctacgagaaccagagggaactgtcttcagggacagaggtgcctgggtgccaagagggcctgacccgtgatgtgatccctcgaccagacccagggacatcagatctgaggggtaggaccagggccctggg^GAGCTTATGTTCTCAGAAAGGTTTTGAGGAGGAGGTGACTTTGATGTGGGGCTACC^gaaatgcccggcacttggg^AAGCAGAAGTTGCTGTCCTGGAACTCACTTTGTAGACCAGGCTGGCTTCAAACTCAGAAATTTGCCTGCCTCTGCCTCCCGAGTGCTGGGATTAAAGGCGTGTGC
This mutation is a 593 bp deletion beginning at Chromosome 7 position 127,589,325 bp and ending after 127,589,917 bp (GRCm38/mm10). There is a 3 bp (TAC) retention 95 bp (7:127589325-127589419) after the beginning of the 593 bp deletion followed by 495 bp of additional deleted sequence. In addition, 56 bp after the deletion there is a 7 bp insertion (CACATCA) and a 19 bp deletion (GAAATGCCCGGCACTTGGG), that will not alter the results of the deletion.
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
40562 | CAG ACC CAG GGA CAT CAG A | Wild type Forward | A | |||
40563 | CCC CAC ATC AAA GTC ACC TC | Common | A | |||
40564 | CCT TCT GGC CTT TTA CTT ATG C | Mutant Forward | A | |||
40565 | Fluorophore-1 | TCT GAG GGG TAG GAC CAG G | Quencher-1 | WT Probe | ||
42296 | Fluorophore-2 | AGT CCT GTG TTA CGA GCT TAT GTT C | Quencher-2 | MUT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
40562 | 0.40 uM |
40563 | 0.40 uM |
40564 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |