Protocol 35246: Probe Assay - Ccr2<tm2.1Ifc> Probe
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr9:124020345+124020465 121bp GCAAGGCTATTTGGATTAAGGA TATGCCGTGGATGAACTGAG

Mutant=  116 bp

Wild Type = 121 bp

Sequence

Wt Sequence: GCAAGGCTATTTGGATTAAGGAATTTGGCATTTGTGTTACAAATAATCATTTTGTTCTCTGACCACAGAATCAAAGgaAATGGAAGACAATAATATGTTACCTCAGTTCATCCACGGCATA

 

Mutant Sequence: GCAAGGCTATTTGGATTAAGGAATTTGGCATTTGTGTTACAAATAATCATTTTGTTCTCTGACCACAGAATCAAAGGccatggcttcctccgaggacgtcatcaaggagttcatgc

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
45609 GCA AGG CTA TTT GGA TTA AGG A Common A
45610 GCA TGA ACT CCT TGA TGA CG Mutant Reverse A RFP
45611 TAT GCC GTG GAT GAA CTG AG Wild type Reverse A
45612 Fluorophore-1 AGA ATC AAA GGC CAT GGC TTC Quencher-1 MUT Probe
45613 Fluorophore-2 CAA AGG AAA TGG AAG ACA ATA ATA TGT T Quencher-2 WT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
45609 0.40 uM
45610 0.40 uM
45611 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.