For in-depth product & services help, ask our
Technical Information Scientists
Protocol 21446: Probe Assay - Smn1<tm1Msd> Probe Alternate2
Version 1.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 115 bp
Wild Type = 126 bp
Sequence
Wt Sequence: ttaagcacatctatctataacttattttttattttttctccctcttcagagTGATGATTCTGACATTTGGGATGATACAGCATTGATAAAAGcttaTGATAAAGCTGTGGCTTCCTTTAAGgtatgaaatggttaatcatttttttcc
ttatttcctcaggtcat
Mutant Sequence: CTCCCTCTTCAGAGTGATGATTCTGACATTTGGGATGATACAGCATTGATAAAAGctcatTCCGCGGGTTTTCATGTACCCAGCATGGGGGATCCCGTCGTTTTACAACGTCGT
GACTGGGAAAACCCTGGCGTT
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 14849 | GAT GAT TCT GAC ATT TGG GAT G | Common | A | |||
| 31897 | Fluorophore-1 | TGA TAA AAG CTT ATG ATA AAG CTG TGG | Quencher-1 | WT Probe | ||
| 32466 | CTT TAC AAA ATG TAT GAC CTG AGG A | Wild type Reverse | A | |||
| 32467 | AGG GTT TTC CCA GTC ACG | Mutant Reverse | A | LacZ | ||
| 32468 | Fluorophore-2 | TTT CAT GTA CCC AGC ATG GG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 14849 | 0.40 uM |
| 32466 | 0.40 uM |
| 32467 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
| Stock Number | Strain Name |
|---|---|
| 007222 | B6.Cg-Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(SMN1*A2G)2023Ahmb/J |
| 006964 | B6.Cg-Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(SMN2*delta7)4299Ahmb/J |
| 006773 | B6.Cg-Grm7Tg(SMN2)89Ahmb Smn1tm1Msd/J |
| 008629 | B6.Cg-Tg(SMN2)11Tro Smn1tm1Msd/J |
| 008631 | B6.Cg-Tg(SMN2)11Tro Tg(SMN2)46Tro Smn1tm1Msd/J |
| 008630 | B6.Cg-Tg(SMN2)46Tro Smn1tm1Msd/J |
| 006385 | B6;129P2-Syt1tm3Sud/J |
| 006386 | B6;129P2-Syt1tm5Sud/J |
| 006214 | FVB.129P2-Smn1tm1Msd/J |
| 008782 | FVB.Cg-Grm7Tg(SMN2)89Ahmb Tg(SMN2*A111G)588Ahmb Smn1tm1Msd/J |
| 008209 | FVB.Cg-Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(ACTA1-SMN)69Ahmb/J |
| 007968 | FVB.Cg-Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(SMN1*A2G)2023Ahmb/2J |
| 005026 | FVB.Cg-Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(SMN1*A2G)2023Ahmb/J |
| 009134 | FVB.Cg-Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(SMN2*A111G)591Ahmb/J |
| 007952 | FVB.Cg-Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(SMN2*delta7)4299Ahmb/2J |
| 005025 | FVB.Cg-Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(SMN2*delta7)4299Ahmb/J |
| 031906 | FVB.Cg-Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(SMN2-SMN1*T274I)5Ahmb/J |
| 007949 | FVB.Cg-Grm7Tg(SMN2)89Ahmb Smn1tm1Msd/2J |
| 005024 | FVB.Cg-Grm7Tg(SMN2)89Ahmb Smn1tm1Msd/J |
| 030214 | FVB.Cg-Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(Prnp-PLS3)14Ahmb Tg(SMN2*delta7)4299Ahmb/J |
| 030970 | FVB.Cg-Mapk10tm1Flv Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(SMN2*delta7)4299Ahmb/LganJ |
| 005058 | FVB.Cg-Smn1tm1Hung Tg(SMN2)2Hung/J |
| 034287 | FVB.Cg-Smn1tm1Msd Tg(SMN2)1Cdid/J |
| 008206 | FVB.Cg-Smn1tm1Msd Tg(SMN2)566Ahmb/J |
| 031909 | FVB.Cg-Tg(SMN2*A111G)588Ahmb Tg(SMN2-SMN1*Q282A)2Ahmb Smn1tm1Msd/J |
| 031907 | STOCK Grm7Tg(SMN2)89Ahmb Tg(SMN2-SMN1*Q282A)2Ahmb Smn1tm1Msd/J |
| 008203 | STOCK Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(ACTA1-SMN)63Ahmb/J |
| 006553 | STOCK Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(H2-K1-tsA58)6Kio Tg(SMN2*delta7)4299Ahmb/J |
| 032003 | STOCK Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(Hlxb9-GFP)1Tmj Tg(SMN2*delta7)4299Ahmb/J |
| 006570 | STOCK Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(Hlxb9-GFP)1Tmj/J |
| 008212 | STOCK Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(Prnp-SMN)92Ahmb/J |
| 025102 | STOCK Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(Rnu7-SMN2*,PGK1-EGFP)4Dasch/DaschMmjax |
| 018916 | STOCK Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(SMN1-SMN2*)16Cll/CllJ |
| 031908 | STOCK Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(SMN2-SMN1*D44V)10Ahmb/J |
| 008783 | STOCK Grm7Tg(SMN2)89Ahmb Smn1tm3(SMN2/Smn1)Mrph Tg(CAG-cre/Esr1*)5Amc Tg(SMN2*delta7)4299Ahmb/J |
| 017596 | STOCK Gt(ROSA)26Sortm1.1(rtTA,EGFP)Nagy Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(SMN2*delta7)4299Ahmb Tg(tetO-SMN2,-luc)#aAhmb/J |
| 017597 | STOCK Gt(ROSA)26Sortm1.1(rtTA,EGFP)Nagy Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(SMN2*delta7)4299Ahmb Tg(tetO-SMN2,-luc)#bAhmb/J |
| 007022 | STOCK Mnx1tm4(cre)Tmj Grm7Tg(SMN2)89Ahmb Smn1tm1Msd Tg(SMN2*delta7)4299Ahmb/J |
| 38 strains use this protocol | |