Genotyping Protocols Database
Protocol 35216: Probe Assay - Tg(APPSwe,tauP301L)1Lfa-Chr2-Probe-alt3
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  109 bp

Wild Type = 108 bp

>chr2:87702578+87702685 108bp CTTGGAACATTGGGGAGACT TCCCGCGTTAGTCTCGTGTA

Sequence

Wt Sequence:
ggatattagcccaaaacctaggatAcccaagatCcttactgcattcttacaggattcTaagctccttggcttctgggaccttggaACattggggagacttaactatatcagaatttaatcTTaaaaggcaTttataataaaatactaaaagagagctcgtagttccatacacgagactaacgcgggaatagggtatgagtatatgggtaaatgagaacaccaaa
 
Mutant Sequence:
GCCTGGAAGACCTGGGACTCCTGCCCATATGTCCTAAGCTCCCCACCCACCCACTCGTTCACTGTCCTTATTCTCTCTCTACCTTCAGCCACTTAGTTTCCTACCTTAAGTCCTAGAATTgatcctggcgtaatagcgaagaggcCcgcaccgataaAAGGCATTTATAATAAAATACTAAAAGAGAGCTCGTAGTTCCATACACGAGACTAACGcgggaatag

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
44088 CTT GGA ACA TTG GGG AGA CT Wild type Forward A
44089 TCC CGC GTT AGT CTC GTG TA Common A
44091 CCT AGA ATT GAT CCT GGC GTA Mutant Forward A
45525 Fluorophore-1 AGA ATT TAA TCT TAA AAG GCA TTT ATA AT Quencher-1 WT Probe
45529 Fluorophore-2 ATA GCG AAG AGG CCC GCA C Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
44088 0.40 uM
44089 0.40 uM
44091 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
031988 129S4.Cg-Tg(APPSwe,tauP301L)1Lfa Psen1tm1Mpm/LfaJ
004807 B6;129-Tg(APPSwe,tauP301L)1Lfa Psen1tm1Mpm/Mmjax
2 strains use this protocol