For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 031952
Protocol 36333: End Point Analysis Assay - Shc2<em1Adiuj>
Version 1.0
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant = A, A
Wild type = G, G
>chr10:79621045-79621147 103bp TCATAGACTATCACCTGAAGAATGG ACTACACACCTGGCTCATGG
Sequence
GTGCGGACGAAAGATGTGTTGTTTGAGAGCATCAGCCACCTCATAGACTATCACCTGAAGAATGGGCTGCCTATCGTGGCTGCTGAGAGCGAGCTGCATCTGCG(g/a)GGA(g/a)TGGTCTCTCGGGAGCCATGAGCCAGgtgtgtagtagccatctgcatcaggcggctacgcctgccatctgtgaggttcctgtgtttgaagactgatccgcagtc
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 48464 | TCA TAG ACT ATC ACC TGA AGA ATG G | Forward | A | |||
| 48465 | ACT ACA CAC CTG GCT CAT GG | Reverse | A | |||
| 48466 | Fluorophore-1 | ATC TGC GGG GAG TGG TCT | Quencher-1 | WT Probe | ||
| 48468 | Fluorophore-2 | CAT CTG CGA GGA ATG GTC TCT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 48464 | 0.40 uM |
| 48465 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.