Genotyping Protocols Database
Protocol 34671: End Point Analysis Assay - Clasp2<em1Adiuj>
Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = C, A, G

Wild type = T, G, C

>chr9:113680882+113680952 71bp CCCCTTAAATTATATTTAGCTTTGG GACACATAAATGCGGCACCA

Sequence

aaagtagaagaaaaagaagatagtaccaggatattttgttcactctttaaatgaaactaaaatttttttccccttaaattatatttagCTTTGGGACTCAACCAC(t/c)(g/a)GT(c/g)ATCAGCAAGTTGGTGCCGCATTTATGTGTCTTATTTGGAGACTCTAACAGTCAGgtaaaaacattacttaccttcaagcattgact

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
44190 CCC CTT AAA TTA TAT TTA GCT TTG G Forward A
44191 GAC ACA TAA ATG CGG CAC CA Reverse A
44192 Fluorophore-1 CAA CCA CTG GTC ATC AGC AA Quencher-1 WT Probe
44193 Fluorophore-2 CAA CCA CCA GTG ATC AGC AA Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
44190 0.40 uM
44191 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.