For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 031942
Protocol 37883: Probe Assay - Apoe<tm1.1(APOE*4)Adiuj>-Probe
Version 1.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr7:19698121-19698270 150bp AATTTTTCCCTCCGCAGACT CTAGGGCTAGAATAGAGTCCACAG
Mut= 150 bp
Wt= 150 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence: TCCACCCCCGCCCCCTGGTGTTCAAAGACAATTTTTCCCTCCGCAGACTGGCCAATCACaaTTGCGAAGATGAAGGCTCTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGTATGGagcaaggacttgctgtggtgccgctttttctgctcctctgtggactctattctagccctagatctcttctgctggtgggttgaggctgaggcggttctgagacctctctgagattcaatagccctgagcag
Mutant Sequence: ATGGCTCACAGATCTGAGAAGGGAAGATGGGGTTCTCTGGGTGGCCGGAGTCCCTCCACCCCCGCCCCCTGGTGTTCAAAGACAATTTTTCCCTCCGCAGACTGGCCAATCACAggcaggaagatgaaggttctgtgggctgcgttgctggtcacattcctggcaggtatggGGGCGGGGCTTGCTCGGTTCCCCCCGCTCCTCCCCCTCTCATCCTCACCTCAACCTCCTGGCCCCATtcaggcagaccctgggccccctcttctgaggcttctgtgctgcttcctggctctgaacagcgatttgacgctctctgggcctcggtttcccccatccttgagataggagtta
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 24463 | AAT TTT TCC CTC CGC AGA CT | Common | A | |||
| 52413 | CTA GGG CTA GAA TAG AGT CCA CAG | Wild type Reverse | A | |||
| 52414 | CCA GGA GGT TGA GGT GAG GAT | Mutant Reverse | A | |||
| 52415 | Fluorophore-1 | AGC AAG GAC TTG CTG TGG TG | Quencher-1 | WT Probe | ||
| 52416 | Fluorophore-2 | CCG CTC CTC CCC CTC T | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 24463 | 0.40 uM |
| 52413 | 0.40 uM |
| 52414 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
| Stock Number | Strain Name |
|---|---|
| 034455 | B6(SJL)-Apoeem2(APOE*)Adiuj Appem1Adiuj/J |
| 034415 | B6(SJL)-Apoetm1.1(APOE*4)Adiuj Appem1Adiuj/J |
| 034454 | B6(SJL)-Apoetm1.1(APOE*4)Adiuj Plcg2em3Adiuj Appem1Adiuj Trem2em1Adiuj/J |
| 028709 | B6(SJL)-Apoetm1.1(APOE*4)Adiuj Trem2em1Adiuj/J |
| 027894 | B6(SJL)-Apoetm1.1(APOE*4)Adiuj/J |
| 031668 | B6(SJL)-Cr2tm1(CR2,CR1)How Apoetm1.1(APOE*4)Adiuj Trem2em1Adiuj/J |
| 033868 | B6.Cg-Adamts4em1Adiuj Apoetm1.1(APOE*4)Adiuj Appem1Adiuj Trem2em1Adiuj/J |
| 029018 | B6.Cg-Apoeem2(APOE*)Adiuj/J |
| 029017 | B6.Cg-Apoeem3(APOE*)Adiuj/J |
| 030320 | B6.Cg-Apoetm1.1(APOE*4)Adiuj Abca7em1Adiuj Trem2em1Adiuj/J |
| 036243 | B6.Cg-Apoetm1.1(APOE*4)Adiuj Abca7em2Adiuj Appem1Adiuj Trem2em1Adiuj/J |
| 030283 | B6.Cg-Apoetm1.1(APOE*4)Adiuj Abca7em2Adiuj Trem2em1Adiuj/J |
| 033873 | B6.Cg-Apoetm1.1(APOE*4)Adiuj Appem1Adiuj Cd2apem1Adiuj Trem2em1Adiuj/J |
| 033869 | B6.Cg-Apoetm1.1(APOE*4)Adiuj Appem1Adiuj Trem2em1Adiuj Bin1em1Adiuj/J |
| 030670 | B6.Cg-Apoetm1.1(APOE*4)Adiuj Appem1Adiuj Trem2em1Adiuj/J |
| 031722 | B6.Cg-Apoetm1.1(APOE*4)Adiuj Appem2Adiuj Trem2em1Adiuj/J |
| 030673 | B6.Cg-Apoetm1.1(APOE*4)Adiuj Ceacam1em1Adiuj Trem2em1Adiuj/J |
| 031944 | B6.Cg-Apoetm1.1(APOE*4)Adiuj Clasp2em1Adiuj Trem2em1Adiuj/J |
| 030304 | B6.Cg-Apoetm1.1(APOE*4)Adiuj Il1rapem1Adiuj Trem2em1Adiuj/J |
| 032777 | B6.Cg-Apoetm1.1(APOE*4)Adiuj Il1rapem2Adiuj Appem1Adiuj Trem2em1Adiuj/J |
| 033541 | B6.Cg-Apoetm1.1(APOE*4)Adiuj Il34em1Adiuj Appem1Adiuj Trem2em1Adiuj/J |
| 033770 | B6.Cg-Apoetm1.1(APOE*4)Adiuj Meox2tm1(cre)Sor Trem2em1Adiuj/J |
| 030674 | B6.Cg-Apoetm1.1(APOE*4)Adiuj Plcg2em3Adiuj Trem2em1Adiuj/J |
| 033913 | B6.Cg-Apoetm1.1(APOE*4)Adiuj Ptk2bem1Adiuj Appem1Adiuj Trem2em1Adiuj/J |
| 033867 | B6.Cg-Apoetm1.1(APOE*4)Adiuj Ptprbem1Adiuj Appem1Adiuj Trem2em1Adiuj/J |
| 032775 | B6.Cg-Apoetm1.1(APOE*4)Adiuj Scimpem1Adiuj Appem1Adiuj Trem2em1Adiuj/J |
| 031942 | B6.Cg-Apoetm1.1(APOE*4)Adiuj Snx1em1Adiuj Trem2em1Adiuj/J |
| 031940 | B6.Cg-Apoetm1.1(APOE*4)Adiuj Sorl1em1Adiuj Trem2em1Adiuj/J |
| 033875 | B6.Cg-Epha1em1Adiuj Apoetm1.1(APOE*4)Adiuj Appem1Adiuj Trem2em1Adiuj/J |
| 031938 | B6.Cg-Kif21bem1Adiuj Apoetm1.1(APOE*4)Adiuj Trem2em1Adiuj/J |
| 036242 | B6.Cg-Mthfrem1Adiuj Apoetm1.1(APOE*4)Adiuj Appem1Adiuj Trem2em1Adiuj/J |
| 030922 | B6.Cg-Mthfrem1Adiuj Apoetm1.1(APOE*4)Adiuj Trem2em1Adiuj/J |
| 032774 | B6.Cg-Pilraem1Adiuj Apoetm1.1(APOE*4)Adiuj Appem1Adiuj Trem2em1Adiuj/J |
| 031946 | B6;SJL-Apoetm1.1(APOE*4)Adiuj Erc2em1Adiuj Trem2em1Adiuj/J |
| 031950 | B6;SJL-Apoetm1.1(APOE*4)Adiuj Mtmr4em1Adiuj Trem2em1Adiuj/J |
| 030771 | B6;SJL-Apoetm1.1(APOE*4)Adiuj Plcg2em1Msasn Trem2em1Adiuj/J |
| 031952 | B6;SJL-Apoetm1.1(APOE*4)Adiuj Shc2em1Adiuj Trem2em1Adiuj/J |
| 031948 | B6;SJL-Slc6a17em1Adiuj Apoetm1.1(APOE*4)Adiuj Trem2em1Adiuj/J |
| 38 strains use this protocol | |