Genotyping Protocols Database
Protocol 35078: End Point Analysis Assay - Sorl1<em1Adiuj>
Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = A, C, C

Wild type = G, A, G

Sequence

GCTCTGTGGGAAAGAACTTGGCCAGCAAGACCAATGTGTACATCTCTAGCAGTGCTGGA(g/a)CC(a/c)G(g/c)TGGAGAGAGgtcagttcctggtcccggagcttttgttagtgtgagcacgtgagctg

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
45199 GCC AGC AAG ACC AAT GTG TA Forward A
45200 TAA CAA AAG CTC CGG GAC CA Reverse A
45201 Fluorophore-1 CTG GAG CCA GGT GGA GAG Quencher-1 WT Probe
45202 Fluorophore-2 CTG GAA CCC GCT GGA GA Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
45199 0.40 uM
45200 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.