Protocol 35580: End Point Analysis Assay - Kif21b<em1Adiuj>-alternate1
Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = G/G
Heterozygote = A/G
Wild type = A/A

Sequence

ATCTATTCGACCTGTGTGAGCAAACTCATCGAAGGCTGCTTTGAGGGCTATAATGCCAC(a/g)GTCCTAGCCTATGGACAGgtaagccactgctacccaaaccagtgagcttgt

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
45920 CAA ACT CAT CGA AGG CTG CT Forward A
45921 ACT GGT TTG GGT AGC AGT GG Reverse A
45922 Fluorophore-1 CTA TAA TGC CAC AGT CCT AGC CTA T Quencher-1 WT Probe
46438 Fluorophore-2 AAT GCC ACG GTC CTA GC Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
45920 0.40 uM
45921 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.