For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 031938
Protocol 35580: End Point Analysis Assay - Kif21b<em1Adiuj>-alternate1
Version 1.0
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant = G/G
Heterozygote = A/G
Wild type = A/A
Sequence
ATCTATTCGACCTGTGTGAGCAAACTCATCGAAGGCTGCTTTGAGGGCTATAATGCCAC(a/g)GTCCTAGCCTATGGACAGgtaagccactgctacccaaaccagtgagcttgt
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 45920 | CAA ACT CAT CGA AGG CTG CT | Forward | A | |||
| 45921 | ACT GGT TTG GGT AGC AGT GG | Reverse | A | |||
| 45922 | Fluorophore-1 | CTA TAA TGC CAC AGT CCT AGC CTA T | Quencher-1 | WT Probe | ||
| 46438 | Fluorophore-2 | AAT GCC ACG GTC CTA GC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 45920 | 0.40 uM |
| 45921 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.